Incidental Mutation 'R3811:Chsy3'
ID356362
Institutional Source Beutler Lab
Gene Symbol Chsy3
Ensembl Gene ENSMUSG00000058152
Gene Namechondroitin sulfate synthase 3
Synonyms4833446K15Rik
MMRRC Submission 040767-MU
Accession Numbers

Ncbi RefSeq: NM_001081328.1; MGI:1926173

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3811 (G1)
Quality Score78
Status Validated
Chromosome18
Chromosomal Location59175401-59410446 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 59176170 bp
ZygosityHeterozygous
Amino Acid Change Proline to Arginine at position 165 (P165R)
Ref Sequence ENSEMBL: ENSMUSP00000079546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080721]
Predicted Effect probably benign
Transcript: ENSMUST00000080721
AA Change: P165R

PolyPhen 2 Score 0.418 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000079546
Gene: ENSMUSG00000058152
AA Change: P165R

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 60 78 N/A INTRINSIC
low complexity region 84 96 N/A INTRINSIC
low complexity region 125 144 N/A INTRINSIC
Pfam:Fringe 169 410 9.4e-19 PFAM
Pfam:CHGN 330 866 1.4e-194 PFAM
Pfam:Glyco_tranf_2_2 652 841 1.8e-7 PFAM
Pfam:Glyco_transf_7C 769 839 3.2e-12 PFAM
Meta Mutation Damage Score 0.0604 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CSS3 is a glycosyltransferase that has both glucuronyltransferase and N-acetylgalactosaminyltransferase activities (Yada et al., 2003 [PubMed 12907687]).[supplied by OMIM, Mar 2008]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl3 G T 6: 34,799,729 S385I probably damaging Het
Arhgap28 G A 17: 67,896,093 P122S probably benign Het
Arid2 T C 15: 96,289,086 V73A probably benign Het
Atp1b1 C T 1: 164,443,305 R35H probably benign Het
Cacybp T C 1: 160,203,652 D202G probably benign Het
Creb3 C T 4: 43,565,501 Q227* probably null Het
Crnkl1 C A 2: 145,931,306 R140L probably damaging Het
Cyth4 A G 15: 78,604,649 E39G probably damaging Het
Dnah6 T C 6: 73,191,498 T481A probably benign Het
Dock4 T A 12: 40,779,124 I1003N possibly damaging Het
Galntl5 T C 5: 25,186,180 F26L probably benign Het
Glrx5 C G 12: 105,032,888 C63W probably damaging Het
Gm9602 T A 14: 4,776,499 I28N probably damaging Het
Hivep2 A G 10: 14,130,357 T900A probably benign Het
Hmcn1 A G 1: 150,649,577 probably null Het
Ighv1-24 G T 12: 114,773,065 L72I probably benign Het
Ilvbl G A 10: 78,579,035 C244Y probably benign Het
Kat7 A G 11: 95,291,615 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Lamc1 A T 1: 153,262,708 probably null Het
Mall T A 2: 127,708,854 I129F probably damaging Het
Mdn1 A T 4: 32,693,506 K1044* probably null Het
Med23 A T 10: 24,892,592 R77* probably null Het
Med23 G A 10: 24,892,593 probably null Het
Metap2 A T 10: 93,870,164 L252* probably null Het
Olfr1066 A T 2: 86,455,347 V308E probably benign Het
Psmd1 T A 1: 86,132,715 V828D probably damaging Het
Psmd9 C T 5: 123,234,590 probably benign Het
Rbbp5 T C 1: 132,492,587 V59A probably damaging Het
Sco2 T C 15: 89,373,679 probably benign Het
Slc32a1 G T 2: 158,614,736 C437F possibly damaging Het
Spem2 T C 11: 69,817,164 E325G possibly damaging Het
Steap4 A G 5: 7,977,017 T327A probably benign Het
Tsc2 T C 17: 24,629,037 D70G probably benign Het
Txndc5 T C 13: 38,523,405 K99E probably benign Het
Other mutations in Chsy3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Chsy3 APN 18 59176367 missense probably damaging 1.00
IGL01543:Chsy3 APN 18 59410400 nonsense probably null
IGL01627:Chsy3 APN 18 59176295 missense probably damaging 1.00
IGL02232:Chsy3 APN 18 59409311 missense possibly damaging 0.89
IGL02604:Chsy3 APN 18 59409115 missense probably benign 0.00
IGL02888:Chsy3 APN 18 59409995 missense probably benign 0.00
IGL03199:Chsy3 APN 18 59176401 missense probably damaging 1.00
bajo UTSW 18 59176166 frame shift probably null
bajo2 UTSW 18 59176419 missense probably damaging 1.00
P0045:Chsy3 UTSW 18 59409006 nonsense probably null
R0456:Chsy3 UTSW 18 59176478 missense probably damaging 1.00
R0605:Chsy3 UTSW 18 59409053 missense probably damaging 0.97
R1068:Chsy3 UTSW 18 59410289 missense probably damaging 1.00
R1479:Chsy3 UTSW 18 59408913 missense probably benign 0.09
R1654:Chsy3 UTSW 18 59176416 missense probably damaging 1.00
R1868:Chsy3 UTSW 18 59176488 splice site probably null
R1938:Chsy3 UTSW 18 59409512 missense probably damaging 1.00
R2114:Chsy3 UTSW 18 59179489 missense probably damaging 1.00
R2146:Chsy3 UTSW 18 59176472 missense probably benign 0.04
R3693:Chsy3 UTSW 18 59176008 missense possibly damaging 0.88
R3787:Chsy3 UTSW 18 59408998 missense probably damaging 1.00
R3878:Chsy3 UTSW 18 59409773 missense probably damaging 1.00
R4385:Chsy3 UTSW 18 59176352 missense probably benign 0.00
R4385:Chsy3 UTSW 18 59179474 missense possibly damaging 0.95
R4512:Chsy3 UTSW 18 59410187 missense probably damaging 1.00
R4734:Chsy3 UTSW 18 59179413 missense probably benign 0.07
R4751:Chsy3 UTSW 18 59175800 missense possibly damaging 0.66
R4982:Chsy3 UTSW 18 59409575 missense probably benign 0.07
R4982:Chsy3 UTSW 18 59409767 missense possibly damaging 0.78
R5032:Chsy3 UTSW 18 59179471 missense probably damaging 1.00
R5088:Chsy3 UTSW 18 59179535 missense probably damaging 1.00
R5220:Chsy3 UTSW 18 59410030 missense probably damaging 0.99
R5257:Chsy3 UTSW 18 59409794 missense possibly damaging 0.50
R5259:Chsy3 UTSW 18 59410246 missense probably damaging 0.96
R5558:Chsy3 UTSW 18 59176397 missense probably damaging 1.00
R5872:Chsy3 UTSW 18 59176196 missense probably damaging 1.00
R5990:Chsy3 UTSW 18 59176166 frame shift probably null
R5992:Chsy3 UTSW 18 59176166 frame shift probably null
R6064:Chsy3 UTSW 18 59176166 frame shift probably null
R6065:Chsy3 UTSW 18 59176166 frame shift probably null
R6182:Chsy3 UTSW 18 59179342 missense probably benign 0.00
R6881:Chsy3 UTSW 18 59179408 missense probably damaging 1.00
R6985:Chsy3 UTSW 18 59176488 splice site probably null
R7046:Chsy3 UTSW 18 59409803 missense probably benign 0.00
R7078:Chsy3 UTSW 18 59176077 missense possibly damaging 0.51
R7105:Chsy3 UTSW 18 59176419 missense probably damaging 1.00
R7129:Chsy3 UTSW 18 59410298 missense probably damaging 1.00
R7151:Chsy3 UTSW 18 59409285 missense possibly damaging 0.55
R7224:Chsy3 UTSW 18 59408975 missense probably damaging 1.00
R7860:Chsy3 UTSW 18 59409227 missense probably benign 0.10
R8010:Chsy3 UTSW 18 59410154 missense probably damaging 1.00
R8029:Chsy3 UTSW 18 59179447 missense possibly damaging 0.87
R8215:Chsy3 UTSW 18 59175869 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTCCCAGTTTTCGGAGCAGC -3'
(R):5'- TAGGAATCGTCGACCCCTGG -3'

Sequencing Primer
(F):5'- AGTTTTCGGAGCAGCCCCTG -3'
(R):5'- TGGCAGCGCGATGACAG -3'
Posted On2015-11-09