Incidental Mutation 'R3605:Gm10801'
ID356366
Institutional Source Beutler Lab
Gene Symbol Gm10801
Ensembl Gene ENSMUSG00000075015
Gene Namepredicted gene 10801
Synonyms
MMRRC Submission 040670-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.545) question?
Stock #R3605 (G1)
Quality Score51
Status Validated
Chromosome2
Chromosomal Location98662237-98664083 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 98664007 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Threonine at position 143 (R143T)
Ref Sequence ENSEMBL: ENSMUSP00000097276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099683] [ENSMUST00000099684]
Predicted Effect probably benign
Transcript: ENSMUST00000099683
SMART Domains Protein: ENSMUSP00000097275
Gene: ENSMUSG00000075014

DomainStartEndE-ValueType
internal_repeat_1 1 41 1.13e-5 PROSPERO
internal_repeat_2 26 49 4.11e-5 PROSPERO
transmembrane domain 78 96 N/A INTRINSIC
internal_repeat_1 114 174 1.13e-5 PROSPERO
low complexity region 177 188 N/A INTRINSIC
internal_repeat_2 197 219 4.11e-5 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000099684
AA Change: R143T

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000097276
Gene: ENSMUSG00000075015
AA Change: R143T

DomainStartEndE-ValueType
internal_repeat_1 2 73 1.19e-13 PROSPERO
internal_repeat_1 80 167 1.19e-13 PROSPERO
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 95% (40/42)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd35 C T 3: 96,682,181 Q239* probably null Het
Arid4b T C 13: 14,120,241 V36A probably damaging Het
Art2b T A 7: 101,579,945 N249I probably benign Het
Bpifb1 T A 2: 154,211,565 N242K possibly damaging Het
Cd200r1 A G 16: 44,789,576 T53A possibly damaging Het
Cracr2b C T 7: 141,466,146 P370S possibly damaging Het
Crb1 T A 1: 139,237,339 T1016S probably damaging Het
Esrrg A G 1: 188,211,102 H424R possibly damaging Het
Fgfrl1 C A 5: 108,705,423 T213K probably damaging Het
Flrt3 T A 2: 140,661,367 N114Y probably damaging Het
Fsip2 T C 2: 82,984,909 V3662A probably benign Het
Gabra6 T A 11: 42,314,950 I359F probably benign Het
Gal A G 19: 3,414,026 probably null Het
Gm5814 G T 17: 47,410,505 R48L probably damaging Het
Hcn1 G A 13: 117,975,252 G584D unknown Het
Iqgap1 T C 7: 80,723,789 D1484G probably benign Het
Kmt2a G A 9: 44,849,196 T485M probably damaging Het
Kprp C A 3: 92,824,281 Q487H unknown Het
Lctl T C 9: 64,133,193 Y473H probably damaging Het
Lrrc8d G A 5: 105,827,007 C93Y unknown Het
Mnt T A 11: 74,836,920 S211T possibly damaging Het
Mtdh T A 15: 34,114,112 probably benign Het
Nxt1 T C 2: 148,675,479 W47R probably damaging Het
Olfr1312 T A 2: 112,042,823 I70F probably benign Het
Olfr195 T C 16: 59,149,483 I211T probably damaging Het
Plekha7 T C 7: 116,164,242 D313G possibly damaging Het
Ranbp10 A G 8: 105,776,035 S300P probably benign Het
Rbl1 A T 2: 157,177,233 F531I probably damaging Het
Rpap2 A G 5: 107,620,529 D411G probably damaging Het
Sapcd1 A G 17: 35,027,805 F36L probably damaging Het
Svep1 A T 4: 58,066,542 S3181T probably benign Het
Tgfbr2 G A 9: 116,109,892 T314I probably benign Het
Thbs4 G T 13: 92,757,959 C685* probably null Het
Tk2 A G 8: 104,231,171 V181A possibly damaging Het
Traf2 T C 2: 25,530,415 T141A probably benign Het
Ttn C T 2: 76,831,444 probably null Het
Ube3c A G 5: 29,598,938 T180A possibly damaging Het
Yif1b C T 7: 29,238,410 A7V possibly damaging Het
Zfp738 A T 13: 67,671,389 L151* probably null Het
Other mutations in Gm10801
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01100:Gm10801 APN 2 98663983 missense probably benign
IGL01154:Gm10801 APN 2 98663983 missense probably benign
PIT4131001:Gm10801 UTSW 2 98662303 missense probably benign
PIT4142001:Gm10801 UTSW 2 98662303 missense probably benign
R0026:Gm10801 UTSW 2 98663909 splice site probably benign
R0063:Gm10801 UTSW 2 98663840 missense probably benign 0.30
R0334:Gm10801 UTSW 2 98664007 missense possibly damaging 0.66
R0335:Gm10801 UTSW 2 98664007 missense possibly damaging 0.66
R1172:Gm10801 UTSW 2 98663907 splice site probably benign
R1321:Gm10801 UTSW 2 98663907 splice site probably benign
R1871:Gm10801 UTSW 2 98663840 missense probably benign 0.30
R1924:Gm10801 UTSW 2 98663852 missense probably damaging 1.00
R2163:Gm10801 UTSW 2 98664007 missense possibly damaging 0.66
R2306:Gm10801 UTSW 2 98664007 missense possibly damaging 0.66
R2379:Gm10801 UTSW 2 98663840 missense probably benign 0.30
R3078:Gm10801 UTSW 2 98663852 missense probably damaging 1.00
R3892:Gm10801 UTSW 2 98663901 splice site probably null
R3930:Gm10801 UTSW 2 98664016 missense possibly damaging 0.48
R4638:Gm10801 UTSW 2 98664007 missense possibly damaging 0.66
R4709:Gm10801 UTSW 2 98663901 splice site probably null
R5390:Gm10801 UTSW 2 98663806 small insertion probably benign
R5405:Gm10801 UTSW 2 98663806 small insertion probably benign
R5535:Gm10801 UTSW 2 98662499 frame shift probably null
R5653:Gm10801 UTSW 2 98664051 missense probably damaging 1.00
R5747:Gm10801 UTSW 2 98664007 missense possibly damaging 0.66
R5987:Gm10801 UTSW 2 98663807 nonsense probably null
R6086:Gm10801 UTSW 2 98663803 nonsense probably null
R6090:Gm10801 UTSW 2 98663806 small insertion probably benign
R6093:Gm10801 UTSW 2 98663807 nonsense probably null
R6112:Gm10801 UTSW 2 98664064 missense probably benign 0.00
R6184:Gm10801 UTSW 2 98663806 small insertion probably benign
R6352:Gm10801 UTSW 2 98663806 small insertion probably benign
R6357:Gm10801 UTSW 2 98663807 frame shift probably null
R6395:Gm10801 UTSW 2 98663807 small insertion probably benign
R6514:Gm10801 UTSW 2 98663869 missense probably benign 0.19
R6547:Gm10801 UTSW 2 98663803 nonsense probably null
R6560:Gm10801 UTSW 2 98663807 nonsense probably null
R6640:Gm10801 UTSW 2 98663807 nonsense probably null
R6675:Gm10801 UTSW 2 98663806 small insertion probably benign
R6679:Gm10801 UTSW 2 98663806 small insertion probably benign
R6684:Gm10801 UTSW 2 98663807 nonsense probably null
R6758:Gm10801 UTSW 2 98663807 nonsense probably null
R6786:Gm10801 UTSW 2 98663803 nonsense probably null
R6886:Gm10801 UTSW 2 98663806 small insertion probably benign
R7783:Gm10801 UTSW 2 98663807 nonsense probably null
R7823:Gm10801 UTSW 2 98663807 nonsense probably null
R8032:Gm10801 UTSW 2 98663807 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCCATCTGTGTAGAAAGCTG -3'
(R):5'- GTCTACTAAGGAGGCCACAAAC -3'

Sequencing Primer
(F):5'- CCAGGTCTTACAGTGTGCAC -3'
(R):5'- TCTACTAAGGAGGCCACAAACAACTG -3'
Posted On2015-11-11