Incidental Mutation 'R3732:Ciz1'
ID356370
Institutional Source Beutler Lab
Gene Symbol Ciz1
Ensembl Gene ENSMUSG00000039205
Gene NameCDKN1A interacting zinc finger protein 1
Synonyms0610038H21Rik, 2900056O04Rik
MMRRC Submission 040720-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.352) question?
Stock #R3732 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location32352327-32380970 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32367483 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 180 (N180S)
Ref Sequence ENSEMBL: ENSMUSP00000116812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048964] [ENSMUST00000113331] [ENSMUST00000113332] [ENSMUST00000113334] [ENSMUST00000113338] [ENSMUST00000131152] [ENSMUST00000132028] [ENSMUST00000136079]
Predicted Effect probably benign
Transcript: ENSMUST00000048964
AA Change: N180S

PolyPhen 2 Score 0.357 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000048428
Gene: ENSMUSG00000039205
AA Change: N180S

DomainStartEndE-ValueType
coiled coil region 5 45 N/A INTRINSIC
low complexity region 58 80 N/A INTRINSIC
low complexity region 85 99 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
low complexity region 361 390 N/A INTRINSIC
ZnF_U1 534 568 1.23e-1 SMART
ZnF_C2H2 537 561 1.99e0 SMART
ZnF_U1 626 660 2.08e-1 SMART
ZnF_C2H2 629 653 3.02e0 SMART
low complexity region 689 709 N/A INTRINSIC
ZnF_U1 744 779 1.43e-4 SMART
ZnF_C2H2 747 772 9.56e1 SMART
low complexity region 823 845 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113331
AA Change: N156S

PolyPhen 2 Score 0.363 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000108957
Gene: ENSMUSG00000039205
AA Change: N156S

DomainStartEndE-ValueType
coiled coil region 5 45 N/A INTRINSIC
low complexity region 58 80 N/A INTRINSIC
low complexity region 85 100 N/A INTRINSIC
low complexity region 104 116 N/A INTRINSIC
low complexity region 221 232 N/A INTRINSIC
internal_repeat_2 252 284 9.48e-5 PROSPERO
internal_repeat_2 301 333 9.48e-5 PROSPERO
low complexity region 337 366 N/A INTRINSIC
ZnF_U1 510 544 1.23e-1 SMART
ZnF_C2H2 513 537 1.99e0 SMART
ZnF_U1 602 636 2.08e-1 SMART
ZnF_C2H2 605 629 3.02e0 SMART
low complexity region 665 685 N/A INTRINSIC
ZnF_U1 720 755 1.43e-4 SMART
ZnF_C2H2 723 748 9.56e1 SMART
low complexity region 799 821 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113332
AA Change: N180S

PolyPhen 2 Score 0.555 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000108958
Gene: ENSMUSG00000039205
AA Change: N180S

DomainStartEndE-ValueType
coiled coil region 5 45 N/A INTRINSIC
low complexity region 58 80 N/A INTRINSIC
low complexity region 85 99 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
low complexity region 240 251 N/A INTRINSIC
ZnF_U1 480 514 1.23e-1 SMART
ZnF_C2H2 483 507 1.99e0 SMART
Blast:ZnF_U1 543 570 2e-6 BLAST
ZnF_U1 572 606 2.08e-1 SMART
ZnF_C2H2 575 599 3.02e0 SMART
low complexity region 635 655 N/A INTRINSIC
ZnF_U1 690 725 1.43e-4 SMART
ZnF_C2H2 693 718 9.56e1 SMART
low complexity region 769 791 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113334
AA Change: N180S

PolyPhen 2 Score 0.357 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000108960
Gene: ENSMUSG00000039205
AA Change: N180S

DomainStartEndE-ValueType
coiled coil region 5 45 N/A INTRINSIC
low complexity region 58 80 N/A INTRINSIC
low complexity region 85 99 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
low complexity region 361 390 N/A INTRINSIC
ZnF_U1 534 568 1.23e-1 SMART
ZnF_C2H2 537 561 1.99e0 SMART
ZnF_U1 626 660 2.08e-1 SMART
ZnF_C2H2 629 653 3.02e0 SMART
low complexity region 689 709 N/A INTRINSIC
ZnF_U1 744 779 1.43e-4 SMART
ZnF_C2H2 747 772 9.56e1 SMART
low complexity region 823 845 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113338
AA Change: N180S

PolyPhen 2 Score 0.357 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000108964
Gene: ENSMUSG00000039205
AA Change: N180S

DomainStartEndE-ValueType
coiled coil region 5 45 N/A INTRINSIC
low complexity region 58 80 N/A INTRINSIC
low complexity region 85 99 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
low complexity region 361 390 N/A INTRINSIC
ZnF_U1 534 568 1.23e-1 SMART
ZnF_C2H2 537 561 1.99e0 SMART
ZnF_U1 626 660 2.08e-1 SMART
ZnF_C2H2 629 653 3.02e0 SMART
low complexity region 689 709 N/A INTRINSIC
ZnF_U1 744 779 1.43e-4 SMART
ZnF_C2H2 747 772 9.56e1 SMART
low complexity region 823 845 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125482
SMART Domains Protein: ENSMUSP00000120019
Gene: ENSMUSG00000039205

DomainStartEndE-ValueType
ZnF_C2H2 216 240 1.99e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125769
Predicted Effect probably benign
Transcript: ENSMUST00000131152
SMART Domains Protein: ENSMUSP00000141211
Gene: ENSMUSG00000039205

DomainStartEndE-ValueType
coiled coil region 5 45 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000132028
AA Change: N180S

PolyPhen 2 Score 0.683 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000120295
Gene: ENSMUSG00000039205
AA Change: N180S

DomainStartEndE-ValueType
coiled coil region 5 45 N/A INTRINSIC
low complexity region 58 80 N/A INTRINSIC
low complexity region 85 99 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132290
Predicted Effect possibly damaging
Transcript: ENSMUST00000136079
AA Change: N180S

PolyPhen 2 Score 0.683 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000116812
Gene: ENSMUSG00000039205
AA Change: N180S

DomainStartEndE-ValueType
coiled coil region 5 45 N/A INTRINSIC
low complexity region 58 80 N/A INTRINSIC
low complexity region 85 99 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136325
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137220
Predicted Effect unknown
Transcript: ENSMUST00000139637
AA Change: N24S
SMART Domains Protein: ENSMUSP00000122469
Gene: ENSMUSG00000039205
AA Change: N24S

DomainStartEndE-ValueType
low complexity region 85 96 N/A INTRINSIC
low complexity region 201 230 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145957
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147338
Predicted Effect unknown
Transcript: ENSMUST00000151806
AA Change: N4S
SMART Domains Protein: ENSMUSP00000119429
Gene: ENSMUSG00000039205
AA Change: N4S

DomainStartEndE-ValueType
low complexity region 70 81 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192055
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192758
Meta Mutation Damage Score 0.0687 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 93% (56/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger DNA binding protein that interacts with CIP1, part of a complex with cyclin E. The encoded protein may regulate the cellular localization of CIP1. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice hoomozygous for a knock-out allele exhibit decreased body size and gender specific effects on motor phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik C T 11: 101,988,452 Q17* probably null Het
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Aacs C T 5: 125,506,262 T294M probably damaging Het
Ablim1 A T 19: 57,049,460 probably null Het
Adgrf4 C T 17: 42,672,581 G70E probably damaging Het
Adgrl3 C A 5: 81,794,946 H1474Q probably benign Het
Adgrv1 T C 13: 81,556,956 I1578M probably damaging Het
Afg3l1 G A 8: 123,501,233 G547D probably damaging Het
Ambra1 G A 2: 91,810,131 R635H probably damaging Het
Araf TACACACACACACACACA TACACACACACACACA X: 20,850,226 probably benign Het
Arhgef10l AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 4: 140,581,619 probably benign Het
Bcl7b A G 5: 135,180,913 T141A probably benign Het
Calm5 T A 13: 3,854,337 N10K probably damaging Het
Camsap1 T C 2: 25,938,344 R1123G probably damaging Het
Chrna3 T C 9: 55,015,894 K210R probably benign Het
Cntnap3 G A 13: 64,740,999 A1162V possibly damaging Het
Cox5b C T 1: 36,693,260 P114L probably damaging Het
Cpsf2 T C 12: 101,987,308 I199T probably damaging Het
Cyp2a4 A G 7: 26,312,827 D345G probably damaging Het
Cyp2s1 C T 7: 25,803,954 R424Q probably null Het
D1Pas1 C A 1: 186,968,097 S74R probably benign Het
Ddx4 T A 13: 112,611,982 I487F possibly damaging Het
Dnah5 A T 15: 28,409,122 E3562V possibly damaging Het
Dpf3 T C 12: 83,269,507 D330G possibly damaging Het
Edem1 T C 6: 108,841,621 F197L probably damaging Het
Ergic2 T C 6: 148,202,522 D79G probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fam102a G A 2: 32,566,292 S322N probably benign Het
Fam111a T C 19: 12,587,550 L221P possibly damaging Het
Fat1 T C 8: 44,953,269 V1019A possibly damaging Het
Fbxl21 T A 13: 56,527,017 H60Q probably benign Het
Fbxw7 A C 3: 84,925,707 K19Q possibly damaging Het
Gldn A G 9: 54,338,662 K499R possibly damaging Het
Gm5514 T G 19: 21,938,252 noncoding transcript Het
Gria4 C T 9: 4,513,295 M271I probably benign Het
Herc1 C T 9: 66,445,640 T2136I probably damaging Het
Igsf10 A G 3: 59,325,714 F1866S probably benign Het
Iqcg G T 16: 33,053,626 probably benign Het
Itih2 A T 2: 10,105,670 F537I probably benign Het
Itpr2 T C 6: 146,382,700 D533G probably damaging Het
Kcnk15 A G 2: 163,853,813 K22E probably benign Het
Lag3 A T 6: 124,910,140 S155T probably benign Het
Lars T C 18: 42,212,602 E1003G probably benign Het
Layn T A 9: 51,059,544 N233I probably damaging Het
Lgi1 T C 19: 38,306,246 Y465H probably damaging Het
Lrig1 C T 6: 94,611,576 A531T possibly damaging Het
Lrrtm4 A G 6: 80,019,655 probably benign Het
Lsamp T A 16: 42,144,572 L264H probably damaging Het
Mthfd2 T C 6: 83,313,475 E39G probably damaging Het
Mtx2 C A 2: 74,847,262 A22E probably damaging Het
Nipal3 T C 4: 135,463,846 T325A probably damaging Het
Nlrp14 A T 7: 107,182,367 Y257F probably benign Het
Ola1 G C 2: 73,156,860 R143G probably damaging Het
Olfr301 T G 7: 86,412,633 I90M probably damaging Het
Otog A G 7: 46,288,368 T1834A probably benign Het
Oxr1 T C 15: 41,848,701 I656T probably damaging Het
Panx1 GTTCTTCT GTTCT 9: 15,006,171 probably benign Het
Pcdh18 T C 3: 49,754,791 S692G probably benign Het
Pcdhga1 A G 18: 37,664,123 T727A probably benign Het
Pde9a A G 17: 31,448,427 E3G possibly damaging Het
Prl8a1 T C 13: 27,579,733 E37G probably damaging Het
Rlf C T 4: 121,148,324 G1153D probably benign Het
Robo2 A C 16: 73,920,747 L1159W possibly damaging Het
Sfxn5 T C 6: 85,299,276 probably benign Het
Siah2 A G 3: 58,676,250 V205A probably damaging Het
Spindoc A C 19: 7,374,301 L202R probably damaging Het
Spock3 T A 8: 63,345,699 D251E probably damaging Het
Srp68 T A 11: 116,273,956 K51* probably null Het
Ssbp2 T C 13: 91,524,607 Y29H probably damaging Het
Sspo T C 6: 48,449,930 V231A probably damaging Het
Stk4 T A 2: 164,088,908 M143K probably benign Het
Tecta C T 9: 42,392,106 V77M possibly damaging Het
Trpc3 A T 3: 36,638,559 D761E probably benign Het
Tubb2a T C 13: 34,075,264 E181G probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ush2a C A 1: 188,944,760 N4756K probably benign Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Wapl G A 14: 34,736,764 V928I probably damaging Het
Zfand3 A G 17: 30,192,656 K130R probably benign Het
Zfp934 A T 13: 62,517,785 H347Q probably damaging Het
Other mutations in Ciz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Ciz1 APN 2 32372388 missense probably damaging 1.00
IGL01872:Ciz1 APN 2 32378109 utr 3 prime probably benign
R0029:Ciz1 UTSW 2 32371419 splice site probably benign
R0122:Ciz1 UTSW 2 32371419 splice site probably benign
R0363:Ciz1 UTSW 2 32377363 critical splice donor site probably null
R0373:Ciz1 UTSW 2 32367467 missense probably damaging 1.00
R0653:Ciz1 UTSW 2 32372406 missense probably damaging 1.00
R0816:Ciz1 UTSW 2 32376376 unclassified probably benign
R1255:Ciz1 UTSW 2 32365876 critical splice donor site probably null
R2116:Ciz1 UTSW 2 32367465 missense probably damaging 0.99
R3161:Ciz1 UTSW 2 32370063 missense probably benign 0.11
R4014:Ciz1 UTSW 2 32374344 missense probably damaging 0.96
R4386:Ciz1 UTSW 2 32370099 missense possibly damaging 0.92
R4687:Ciz1 UTSW 2 32367465 missense probably damaging 0.99
R4786:Ciz1 UTSW 2 32377527 missense probably damaging 1.00
R4825:Ciz1 UTSW 2 32371741 missense probably damaging 0.99
R4869:Ciz1 UTSW 2 32364235 missense probably damaging 0.99
R4871:Ciz1 UTSW 2 32372288 splice site probably benign
R5270:Ciz1 UTSW 2 32374499 unclassified probably null
R5429:Ciz1 UTSW 2 32376043 missense possibly damaging 0.93
R5621:Ciz1 UTSW 2 32371741 missense probably damaging 0.96
R5721:Ciz1 UTSW 2 32376040 missense probably damaging 1.00
R5805:Ciz1 UTSW 2 32367396 missense probably damaging 1.00
R5960:Ciz1 UTSW 2 32371216 missense possibly damaging 0.85
R6187:Ciz1 UTSW 2 32370051 missense possibly damaging 0.90
R6612:Ciz1 UTSW 2 32377311 missense possibly damaging 0.93
R7006:Ciz1 UTSW 2 32371115 critical splice donor site probably null
R7200:Ciz1 UTSW 2 32364287 missense probably damaging 1.00
R7498:Ciz1 UTSW 2 32371749 missense probably benign
R7574:Ciz1 UTSW 2 32367368 missense probably benign 0.16
R7910:Ciz1 UTSW 2 32370127 critical splice donor site probably null
X0018:Ciz1 UTSW 2 32371252 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACAGGTAACCTCCGTGCTTTC -3'
(R):5'- GAGATGATAGATGTTAGGCGCC -3'

Sequencing Primer
(F):5'- CGTGCTTTCAATGTGACAGC -3'
(R):5'- GGCGCCTTCATTTTATAGACACTGAG -3'
Posted On2015-11-11