Mutagenetix > Incidental Mutation

Incidental Mutation 'R3732:Ambra1'

356372

Institutional Source

Beutler Lab

Gene Symbol

Ambra1

Ensembl Gene

ENSMUSG00000040506

Gene Name

autophagy/beclin 1 regulator 1

Synonyms

2310079H06Rik, D030051N19Rik

MMRRC Submission

040720-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.923) question?

Stock #

R3732 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

91730134-91918849 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 91810131 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 635 (R635H)

Ref Sequence

ENSEMBL: ENSMUSP00000106949 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045699] [ENSMUST00000045705] [ENSMUST00000099712] [ENSMUST00000111316] [ENSMUST00000111317]

AlphaFold

A2AH22

Predicted Effect

probably damaging
Transcript: ENSMUST00000045699
AA Change: R635H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000048898
Gene: ENSMUSG00000040506
AA Change: R635H

Domain	Start	End	E-Value	Type
WD40	50	81	4.11e1	SMART
WD40	84	124	1.16e-9	SMART
WD40	126	164	1.19e0	SMART
low complexity region	351	361	N/A	INTRINSIC
low complexity region	393	404	N/A	INTRINSIC
low complexity region	538	554	N/A	INTRINSIC
low complexity region	591	603	N/A	INTRINSIC
low complexity region	636	643	N/A	INTRINSIC
Blast:WD40	812	850	1e-5	BLAST
Blast:WD40	871	918	1e-7	BLAST
low complexity region	942	954	N/A	INTRINSIC
low complexity region	1002	1026	N/A	INTRINSIC
low complexity region	1127	1143	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000045705
AA Change: R755H

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000049258
Gene: ENSMUSG00000040506
AA Change: R755H

Domain	Start	End	E-Value	Type
WD40	50	81	4.11e1	SMART
WD40	84	124	1.16e-9	SMART
WD40	126	164	1.19e0	SMART
low complexity region	267	285	N/A	INTRINSIC
low complexity region	442	452	N/A	INTRINSIC
low complexity region	484	495	N/A	INTRINSIC
low complexity region	629	645	N/A	INTRINSIC
low complexity region	682	704	N/A	INTRINSIC
low complexity region	756	763	N/A	INTRINSIC
Blast:WD40	932	970	1e-5	BLAST
Blast:WD40	991	1038	1e-7	BLAST
low complexity region	1062	1074	N/A	INTRINSIC
low complexity region	1122	1146	N/A	INTRINSIC
low complexity region	1247	1263	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000099712
AA Change: R664H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000097299
Gene: ENSMUSG00000040506
AA Change: R664H

Domain	Start	End	E-Value	Type
WD40	50	81	4.11e1	SMART
WD40	84	124	1.16e-9	SMART
WD40	126	164	1.19e0	SMART
low complexity region	351	361	N/A	INTRINSIC
low complexity region	393	404	N/A	INTRINSIC
low complexity region	538	554	N/A	INTRINSIC
low complexity region	591	613	N/A	INTRINSIC
low complexity region	665	672	N/A	INTRINSIC
Blast:WD40	841	879	1e-5	BLAST
Blast:WD40	900	947	1e-7	BLAST
low complexity region	971	983	N/A	INTRINSIC
low complexity region	1031	1055	N/A	INTRINSIC
low complexity region	1156	1172	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000111316

SMART Domains

Protein: ENSMUSP00000106948
Gene: ENSMUSG00000040506

Domain	Start	End	E-Value	Type
WD40	50	81	4.11e1	SMART
WD40	84	124	1.16e-9	SMART
WD40	126	164	1.19e0	SMART
low complexity region	267	285	N/A	INTRINSIC
low complexity region	442	452	N/A	INTRINSIC
low complexity region	484	495	N/A	INTRINSIC
low complexity region	629	645	N/A	INTRINSIC
low complexity region	682	704	N/A	INTRINSIC
Blast:WD40	872	910	1e-5	BLAST
Blast:WD40	931	978	1e-7	BLAST
low complexity region	1002	1014	N/A	INTRINSIC
low complexity region	1062	1086	N/A	INTRINSIC
low complexity region	1187	1203	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000111317
AA Change: R635H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106949
Gene: ENSMUSG00000040506
AA Change: R635H

Domain	Start	End	E-Value	Type
WD40	50	81	4.11e1	SMART
WD40	84	124	1.16e-9	SMART
WD40	126	164	1.19e0	SMART
low complexity region	351	361	N/A	INTRINSIC
low complexity region	393	404	N/A	INTRINSIC
low complexity region	538	554	N/A	INTRINSIC
low complexity region	591	603	N/A	INTRINSIC
low complexity region	636	643	N/A	INTRINSIC
Blast:WD40	812	850	1e-5	BLAST
Blast:WD40	871	918	1e-7	BLAST
low complexity region	942	954	N/A	INTRINSIC
low complexity region	1002	1026	N/A	INTRINSIC
low complexity region	1127	1143	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124132

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133490

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142224

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156496

Meta Mutation Damage Score

0.1714

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.6%

Validation Efficiency

93% (56/60)

MGI Phenotype

PHENOTYPE: Most mice homozygous for a gene trap mutation die at E10-E14.5 with severe neural tube defects manifest as midbrain/hindbrain exencephaly and/or spina bifida and associated with impaired autophagy, accumulation of ubiquitinated proteins, abnormal cell proliferation and excessive apoptosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006E09Rik	C	T	11: 101,988,452	Q17*	probably null	Het
1700012B07Rik	G	T	11: 109,794,154	C172*	probably null	Het
Aacs	C	T	5: 125,506,262	T294M	probably damaging	Het
Ablim1	A	T	19: 57,049,460		probably null	Het
Adgrf4	C	T	17: 42,672,581	G70E	probably damaging	Het
Adgrl3	C	A	5: 81,794,946	H1474Q	probably benign	Het
Adgrv1	T	C	13: 81,556,956	I1578M	probably damaging	Het
Afg3l1	G	A	8: 123,501,233	G547D	probably damaging	Het
Araf	TACACACACACACACACA	TACACACACACACACA	X: 20,850,226		probably benign	Het
Arhgef10l	AGAGGAGGAGGAGGAGGA	AGAGGAGGAGGAGGA	4: 140,581,619		probably benign	Het
Bcl7b	A	G	5: 135,180,913	T141A	probably benign	Het
Calm5	T	A	13: 3,854,337	N10K	probably damaging	Het
Camsap1	T	C	2: 25,938,344	R1123G	probably damaging	Het
Chrna3	T	C	9: 55,015,894	K210R	probably benign	Het
Ciz1	A	G	2: 32,367,483	N180S	possibly damaging	Het
Cntnap3	G	A	13: 64,740,999	A1162V	possibly damaging	Het
Cox5b	C	T	1: 36,693,260	P114L	probably damaging	Het
Cpsf2	T	C	12: 101,987,308	I199T	probably damaging	Het
Cyp2a4	A	G	7: 26,312,827	D345G	probably damaging	Het
Cyp2s1	C	T	7: 25,803,954	R424Q	probably null	Het
D1Pas1	C	A	1: 186,968,097	S74R	probably benign	Het
Ddx4	T	A	13: 112,611,982	I487F	possibly damaging	Het
Dnah5	A	T	15: 28,409,122	E3562V	possibly damaging	Het
Dpf3	T	C	12: 83,269,507	D330G	possibly damaging	Het
Edem1	T	C	6: 108,841,621	F197L	probably damaging	Het
Ergic2	T	C	6: 148,202,522	D79G	probably damaging	Het
Espl1	A	G	15: 102,312,989	I944V	probably damaging	Het
Fam102a	G	A	2: 32,566,292	S322N	probably benign	Het
Fam111a	T	C	19: 12,587,550	L221P	possibly damaging	Het
Fat1	T	C	8: 44,953,269	V1019A	possibly damaging	Het
Fbxl21	T	A	13: 56,527,017	H60Q	probably benign	Het
Fbxw7	A	C	3: 84,925,707	K19Q	possibly damaging	Het
Gldn	A	G	9: 54,338,662	K499R	possibly damaging	Het
Gm5514	T	G	19: 21,938,252		noncoding transcript	Het
Gria4	C	T	9: 4,513,295	M271I	probably benign	Het
Herc1	C	T	9: 66,445,640	T2136I	probably damaging	Het
Igsf10	A	G	3: 59,325,714	F1866S	probably benign	Het
Iqcg	G	T	16: 33,053,626		probably benign	Het
Itih2	A	T	2: 10,105,670	F537I	probably benign	Het
Itpr2	T	C	6: 146,382,700	D533G	probably damaging	Het
Kcnk15	A	G	2: 163,853,813	K22E	probably benign	Het
Lag3	A	T	6: 124,910,140	S155T	probably benign	Het
Lars	T	C	18: 42,212,602	E1003G	probably benign	Het
Layn	T	A	9: 51,059,544	N233I	probably damaging	Het
Lgi1	T	C	19: 38,306,246	Y465H	probably damaging	Het
Lrig1	C	T	6: 94,611,576	A531T	possibly damaging	Het
Lrrtm4	A	G	6: 80,019,655		probably benign	Het
Lsamp	T	A	16: 42,144,572	L264H	probably damaging	Het
Mthfd2	T	C	6: 83,313,475	E39G	probably damaging	Het
Mtx2	C	A	2: 74,847,262	A22E	probably damaging	Het
Nipal3	T	C	4: 135,463,846	T325A	probably damaging	Het
Nlrp14	A	T	7: 107,182,367	Y257F	probably benign	Het
Ola1	G	C	2: 73,156,860	R143G	probably damaging	Het
Olfr301	T	G	7: 86,412,633	I90M	probably damaging	Het
Otog	A	G	7: 46,288,368	T1834A	probably benign	Het
Oxr1	T	C	15: 41,848,701	I656T	probably damaging	Het
Panx1	GTTCTTCT	GTTCT	9: 15,006,171		probably benign	Het
Pcdh18	T	C	3: 49,754,791	S692G	probably benign	Het
Pcdhga1	A	G	18: 37,664,123	T727A	probably benign	Het
Pde9a	A	G	17: 31,448,427	E3G	possibly damaging	Het
Prl8a1	T	C	13: 27,579,733	E37G	probably damaging	Het
Rlf	C	T	4: 121,148,324	G1153D	probably benign	Het
Robo2	A	C	16: 73,920,747	L1159W	possibly damaging	Het
Sfxn5	T	C	6: 85,299,276		probably benign	Het
Siah2	A	G	3: 58,676,250	V205A	probably damaging	Het
Spindoc	A	C	19: 7,374,301	L202R	probably damaging	Het
Spock3	T	A	8: 63,345,699	D251E	probably damaging	Het
Srp68	T	A	11: 116,273,956	K51*	probably null	Het
Ssbp2	T	C	13: 91,524,607	Y29H	probably damaging	Het
Sspo	T	C	6: 48,449,930	V231A	probably damaging	Het
Stk4	T	A	2: 164,088,908	M143K	probably benign	Het
Tecta	C	T	9: 42,392,106	V77M	possibly damaging	Het
Trpc3	A	T	3: 36,638,559	D761E	probably benign	Het
Tubb2a	T	C	13: 34,075,264	E181G	probably damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Ush2a	C	A	1: 188,944,760	N4756K	probably benign	Het
Vmn2r-ps159	G	T	4: 156,334,397		noncoding transcript	Het
Wapl	G	A	14: 34,736,764	V928I	probably damaging	Het
Zfand3	A	G	17: 30,192,656	K130R	probably benign	Het
Zfp934	A	T	13: 62,517,785	H347Q	probably damaging	Het

Other mutations in Ambra1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00264:Ambra1	APN	2	91911589	missense	probably benign	0.01
IGL00861:Ambra1	APN	2	91770926	missense	possibly damaging	0.81
IGL00911:Ambra1	APN	2	91767682	splice site	probably benign
IGL01371:Ambra1	APN	2	91825286	missense	probably damaging	1.00
IGL01532:Ambra1	APN	2	91885632	missense	probably damaging	1.00
IGL01620:Ambra1	APN	2	91911412	critical splice acceptor site	probably null
IGL02147:Ambra1	APN	2	91767719	missense	probably benign	0.01
IGL02170:Ambra1	APN	2	91767087	missense	possibly damaging	0.66
IGL02173:Ambra1	APN	2	91917668	missense	probably benign
IGL02212:Ambra1	APN	2	91917361	missense	probably damaging	1.00
IGL02256:Ambra1	APN	2	91769054	missense	possibly damaging	0.95
IGL02319:Ambra1	APN	2	91886920	missense	probably damaging	1.00
IGL02502:Ambra1	APN	2	91900532	missense	probably damaging	1.00
IGL02961:Ambra1	APN	2	91911448	missense	possibly damaging	0.86
R0003:Ambra1	UTSW	2	91911428	missense	probably damaging	1.00
R0098:Ambra1	UTSW	2	91767711	missense	possibly damaging	0.66
R0173:Ambra1	UTSW	2	91810219	splice site	probably benign
R0414:Ambra1	UTSW	2	91875739	missense	possibly damaging	0.84
R0579:Ambra1	UTSW	2	91824465	missense	possibly damaging	0.66
R1212:Ambra1	UTSW	2	91769036	missense	possibly damaging	0.94
R1241:Ambra1	UTSW	2	91770896	splice site	probably benign
R1467:Ambra1	UTSW	2	91885703	missense	probably damaging	1.00
R1467:Ambra1	UTSW	2	91885703	missense	probably damaging	1.00
R1533:Ambra1	UTSW	2	91886865	missense	probably damaging	1.00
R1916:Ambra1	UTSW	2	91911461	missense	probably damaging	1.00
R2080:Ambra1	UTSW	2	91885719	missense	probably damaging	1.00
R2083:Ambra1	UTSW	2	91766600	missense	possibly damaging	0.83
R2112:Ambra1	UTSW	2	91875787	missense	probably damaging	1.00
R2255:Ambra1	UTSW	2	91917461	missense	probably damaging	1.00
R3407:Ambra1	UTSW	2	91910307	missense	probably damaging	1.00
R4111:Ambra1	UTSW	2	91900558	missense	probably damaging	1.00
R4792:Ambra1	UTSW	2	91772846	missense	possibly damaging	0.66
R4879:Ambra1	UTSW	2	91772694	intron	probably benign
R5007:Ambra1	UTSW	2	91772310	missense	possibly damaging	0.79
R5261:Ambra1	UTSW	2	91885606	missense	probably damaging	1.00
R6141:Ambra1	UTSW	2	91875754	missense	probably damaging	1.00
R6364:Ambra1	UTSW	2	91773316	missense	possibly damaging	0.66
R6413:Ambra1	UTSW	2	91769084	missense	possibly damaging	0.92
R6868:Ambra1	UTSW	2	91917533	missense	possibly damaging	0.83
R6888:Ambra1	UTSW	2	91769027	missense	probably damaging	1.00
R6964:Ambra1	UTSW	2	91917416	nonsense	probably null
R6970:Ambra1	UTSW	2	91772600	intron	probably benign
R6982:Ambra1	UTSW	2	91917473	missense	probably damaging	1.00
R7205:Ambra1	UTSW	2	91767758	missense	possibly damaging	0.46
R7458:Ambra1	UTSW	2	91917684	missense	probably benign	0.26
R7786:Ambra1	UTSW	2	91767796	missense	possibly damaging	0.46
R7812:Ambra1	UTSW	2	91766566	start codon destroyed	probably benign	0.00
R7825:Ambra1	UTSW	2	91767761	missense	probably damaging	1.00
R7860:Ambra1	UTSW	2	91773493	missense	probably benign	0.27
R8190:Ambra1	UTSW	2	91772352	missense	possibly damaging	0.95
R8779:Ambra1	UTSW	2	91917374	missense	probably benign	0.05
R9044:Ambra1	UTSW	2	91910089	intron	probably benign
R9062:Ambra1	UTSW	2	91910317	missense	possibly damaging	0.82
R9707:Ambra1	UTSW	2	91810131	missense	probably damaging	1.00
Z1177:Ambra1	UTSW	2	91768999	missense	possibly damaging	0.81
Z1177:Ambra1	UTSW	2	91875786	missense	probably damaging	0.97
Z1177:Ambra1	UTSW	2	91900608	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- TGGCGAGTTCAATGCTCTATAG -3'
(R):5'- AATGCTCACCACTGCTACAG -3'

Sequencing Primer
(F):5'- CCATGGGCAAGTTGGCTTTTTC -3'
(R):5'- TGCTACAGAAACAGAGGCC -3'

Posted On

2015-11-11