Incidental Mutation 'R3732:Ambra1'
ID 356372
Institutional Source Beutler Lab
Gene Symbol Ambra1
Ensembl Gene ENSMUSG00000040506
Gene Name autophagy/beclin 1 regulator 1
Synonyms 2310079H06Rik, D030051N19Rik
MMRRC Submission 040720-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.905) question?
Stock # R3732 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 91560479-91749194 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 91640476 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 635 (R635H)
Ref Sequence ENSEMBL: ENSMUSP00000106949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045699] [ENSMUST00000045705] [ENSMUST00000099712] [ENSMUST00000111316] [ENSMUST00000111317]
AlphaFold A2AH22
Predicted Effect probably damaging
Transcript: ENSMUST00000045699
AA Change: R635H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048898
Gene: ENSMUSG00000040506
AA Change: R635H

DomainStartEndE-ValueType
WD40 50 81 4.11e1 SMART
WD40 84 124 1.16e-9 SMART
WD40 126 164 1.19e0 SMART
low complexity region 351 361 N/A INTRINSIC
low complexity region 393 404 N/A INTRINSIC
low complexity region 538 554 N/A INTRINSIC
low complexity region 591 603 N/A INTRINSIC
low complexity region 636 643 N/A INTRINSIC
Blast:WD40 812 850 1e-5 BLAST
Blast:WD40 871 918 1e-7 BLAST
low complexity region 942 954 N/A INTRINSIC
low complexity region 1002 1026 N/A INTRINSIC
low complexity region 1127 1143 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000045705
AA Change: R755H

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000049258
Gene: ENSMUSG00000040506
AA Change: R755H

DomainStartEndE-ValueType
WD40 50 81 4.11e1 SMART
WD40 84 124 1.16e-9 SMART
WD40 126 164 1.19e0 SMART
low complexity region 267 285 N/A INTRINSIC
low complexity region 442 452 N/A INTRINSIC
low complexity region 484 495 N/A INTRINSIC
low complexity region 629 645 N/A INTRINSIC
low complexity region 682 704 N/A INTRINSIC
low complexity region 756 763 N/A INTRINSIC
Blast:WD40 932 970 1e-5 BLAST
Blast:WD40 991 1038 1e-7 BLAST
low complexity region 1062 1074 N/A INTRINSIC
low complexity region 1122 1146 N/A INTRINSIC
low complexity region 1247 1263 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099712
AA Change: R664H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097299
Gene: ENSMUSG00000040506
AA Change: R664H

DomainStartEndE-ValueType
WD40 50 81 4.11e1 SMART
WD40 84 124 1.16e-9 SMART
WD40 126 164 1.19e0 SMART
low complexity region 351 361 N/A INTRINSIC
low complexity region 393 404 N/A INTRINSIC
low complexity region 538 554 N/A INTRINSIC
low complexity region 591 613 N/A INTRINSIC
low complexity region 665 672 N/A INTRINSIC
Blast:WD40 841 879 1e-5 BLAST
Blast:WD40 900 947 1e-7 BLAST
low complexity region 971 983 N/A INTRINSIC
low complexity region 1031 1055 N/A INTRINSIC
low complexity region 1156 1172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111316
SMART Domains Protein: ENSMUSP00000106948
Gene: ENSMUSG00000040506

DomainStartEndE-ValueType
WD40 50 81 4.11e1 SMART
WD40 84 124 1.16e-9 SMART
WD40 126 164 1.19e0 SMART
low complexity region 267 285 N/A INTRINSIC
low complexity region 442 452 N/A INTRINSIC
low complexity region 484 495 N/A INTRINSIC
low complexity region 629 645 N/A INTRINSIC
low complexity region 682 704 N/A INTRINSIC
Blast:WD40 872 910 1e-5 BLAST
Blast:WD40 931 978 1e-7 BLAST
low complexity region 1002 1014 N/A INTRINSIC
low complexity region 1062 1086 N/A INTRINSIC
low complexity region 1187 1203 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111317
AA Change: R635H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106949
Gene: ENSMUSG00000040506
AA Change: R635H

DomainStartEndE-ValueType
WD40 50 81 4.11e1 SMART
WD40 84 124 1.16e-9 SMART
WD40 126 164 1.19e0 SMART
low complexity region 351 361 N/A INTRINSIC
low complexity region 393 404 N/A INTRINSIC
low complexity region 538 554 N/A INTRINSIC
low complexity region 591 603 N/A INTRINSIC
low complexity region 636 643 N/A INTRINSIC
Blast:WD40 812 850 1e-5 BLAST
Blast:WD40 871 918 1e-7 BLAST
low complexity region 942 954 N/A INTRINSIC
low complexity region 1002 1026 N/A INTRINSIC
low complexity region 1127 1143 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133490
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142224
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156496
Meta Mutation Damage Score 0.1714 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 93% (56/60)
MGI Phenotype PHENOTYPE: Most mice homozygous for a gene trap mutation die at E10-E14.5 with severe neural tube defects manifest as midbrain/hindbrain exencephaly and/or spina bifida and associated with impaired autophagy, accumulation of ubiquitinated proteins, abnormal cell proliferation and excessive apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,684,980 (GRCm39) C172* probably null Het
Aacs C T 5: 125,583,326 (GRCm39) T294M probably damaging Het
Ablim1 A T 19: 57,037,892 (GRCm39) probably null Het
Adgrf4 C T 17: 42,983,472 (GRCm39) G70E probably damaging Het
Adgrl3 C A 5: 81,942,793 (GRCm39) H1474Q probably benign Het
Adgrv1 T C 13: 81,705,075 (GRCm39) I1578M probably damaging Het
Afg3l1 G A 8: 124,227,972 (GRCm39) G547D probably damaging Het
Araf TACACACACACACACACA TACACACACACACACA X: 20,716,465 (GRCm39) probably benign Het
Arhgef10l AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 4: 140,308,930 (GRCm39) probably benign Het
Bcl7b A G 5: 135,209,767 (GRCm39) T141A probably benign Het
Calm5 T A 13: 3,904,337 (GRCm39) N10K probably damaging Het
Camsap1 T C 2: 25,828,356 (GRCm39) R1123G probably damaging Het
Cfap97d1 C T 11: 101,879,278 (GRCm39) Q17* probably null Het
Chrna3 T C 9: 54,923,178 (GRCm39) K210R probably benign Het
Ciz1 A G 2: 32,257,495 (GRCm39) N180S possibly damaging Het
Cntnap3 G A 13: 64,888,813 (GRCm39) A1162V possibly damaging Het
Cox5b C T 1: 36,732,341 (GRCm39) P114L probably damaging Het
Cpsf2 T C 12: 101,953,567 (GRCm39) I199T probably damaging Het
Cyp2a4 A G 7: 26,012,252 (GRCm39) D345G probably damaging Het
Cyp2s1 C T 7: 25,503,379 (GRCm39) R424Q probably null Het
D1Pas1 C A 1: 186,700,294 (GRCm39) S74R probably benign Het
Ddx4 T A 13: 112,748,516 (GRCm39) I487F possibly damaging Het
Dnah5 A T 15: 28,409,268 (GRCm39) E3562V possibly damaging Het
Dpf3 T C 12: 83,316,281 (GRCm39) D330G possibly damaging Het
Edem1 T C 6: 108,818,582 (GRCm39) F197L probably damaging Het
Eeig1 G A 2: 32,456,304 (GRCm39) S322N probably benign Het
Ergic2 T C 6: 148,104,020 (GRCm39) D79G probably damaging Het
Espl1 A G 15: 102,221,424 (GRCm39) I944V probably damaging Het
Fam111a T C 19: 12,564,914 (GRCm39) L221P possibly damaging Het
Fat1 T C 8: 45,406,306 (GRCm39) V1019A possibly damaging Het
Fbxl21 T A 13: 56,674,830 (GRCm39) H60Q probably benign Het
Fbxw7 A C 3: 84,833,014 (GRCm39) K19Q possibly damaging Het
Gldn A G 9: 54,245,946 (GRCm39) K499R possibly damaging Het
Gria4 C T 9: 4,513,295 (GRCm39) M271I probably benign Het
Herc1 C T 9: 66,352,922 (GRCm39) T2136I probably damaging Het
Igsf10 A G 3: 59,233,135 (GRCm39) F1866S probably benign Het
Iqcg G T 16: 32,873,996 (GRCm39) probably benign Het
Itih2 A T 2: 10,110,481 (GRCm39) F537I probably benign Het
Itpr2 T C 6: 146,284,198 (GRCm39) D533G probably damaging Het
Kcnk15 A G 2: 163,695,733 (GRCm39) K22E probably benign Het
Lag3 A T 6: 124,887,103 (GRCm39) S155T probably benign Het
Lars1 T C 18: 42,345,667 (GRCm39) E1003G probably benign Het
Layn T A 9: 50,970,844 (GRCm39) N233I probably damaging Het
Ldhb-ps T G 19: 21,915,616 (GRCm39) noncoding transcript Het
Lgi1 T C 19: 38,294,694 (GRCm39) Y465H probably damaging Het
Lrig1 C T 6: 94,588,557 (GRCm39) A531T possibly damaging Het
Lrrtm4 A G 6: 79,996,638 (GRCm39) probably benign Het
Lsamp T A 16: 41,964,935 (GRCm39) L264H probably damaging Het
Mthfd2 T C 6: 83,290,457 (GRCm39) E39G probably damaging Het
Mtx2 C A 2: 74,677,606 (GRCm39) A22E probably damaging Het
Nipal3 T C 4: 135,191,157 (GRCm39) T325A probably damaging Het
Nlrp14 A T 7: 106,781,574 (GRCm39) Y257F probably benign Het
Ola1 G C 2: 72,987,204 (GRCm39) R143G probably damaging Het
Or14c44 T G 7: 86,061,841 (GRCm39) I90M probably damaging Het
Otog A G 7: 45,937,792 (GRCm39) T1834A probably benign Het
Oxr1 T C 15: 41,712,097 (GRCm39) I656T probably damaging Het
Panx1 GTTCTTCT GTTCT 9: 14,917,467 (GRCm39) probably benign Het
Pcdh18 T C 3: 49,709,240 (GRCm39) S692G probably benign Het
Pcdhga1 A G 18: 37,797,176 (GRCm39) T727A probably benign Het
Pde9a A G 17: 31,667,401 (GRCm39) E3G possibly damaging Het
Prl8a1 T C 13: 27,763,716 (GRCm39) E37G probably damaging Het
Rlf C T 4: 121,005,521 (GRCm39) G1153D probably benign Het
Robo2 A C 16: 73,717,635 (GRCm39) L1159W possibly damaging Het
Sfxn5 T C 6: 85,276,258 (GRCm39) probably benign Het
Siah2 A G 3: 58,583,671 (GRCm39) V205A probably damaging Het
Spindoc A C 19: 7,351,666 (GRCm39) L202R probably damaging Het
Spock3 T A 8: 63,798,733 (GRCm39) D251E probably damaging Het
Srp68 T A 11: 116,164,782 (GRCm39) K51* probably null Het
Ssbp2 T C 13: 91,672,726 (GRCm39) Y29H probably damaging Het
Sspo T C 6: 48,426,864 (GRCm39) V231A probably damaging Het
Stk4 T A 2: 163,930,828 (GRCm39) M143K probably benign Het
Tecta C T 9: 42,303,402 (GRCm39) V77M possibly damaging Het
Trpc3 A T 3: 36,692,708 (GRCm39) D761E probably benign Het
Tubb2a T C 13: 34,259,247 (GRCm39) E181G probably damaging Het
Ugcg C T 4: 59,207,798 (GRCm39) P46S probably benign Het
Ush2a C A 1: 188,676,957 (GRCm39) N4756K probably benign Het
Vmn2r129 G T 4: 156,686,692 (GRCm39) noncoding transcript Het
Wapl G A 14: 34,458,721 (GRCm39) V928I probably damaging Het
Zfand3 A G 17: 30,411,630 (GRCm39) K130R probably benign Het
Zfp934 A T 13: 62,665,599 (GRCm39) H347Q probably damaging Het
Other mutations in Ambra1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Ambra1 APN 2 91,741,934 (GRCm39) missense probably benign 0.01
IGL00861:Ambra1 APN 2 91,601,271 (GRCm39) missense possibly damaging 0.81
IGL00911:Ambra1 APN 2 91,598,027 (GRCm39) splice site probably benign
IGL01371:Ambra1 APN 2 91,655,631 (GRCm39) missense probably damaging 1.00
IGL01532:Ambra1 APN 2 91,715,977 (GRCm39) missense probably damaging 1.00
IGL01620:Ambra1 APN 2 91,741,757 (GRCm39) critical splice acceptor site probably null
IGL02147:Ambra1 APN 2 91,598,064 (GRCm39) missense probably benign 0.01
IGL02170:Ambra1 APN 2 91,597,432 (GRCm39) missense possibly damaging 0.66
IGL02173:Ambra1 APN 2 91,748,013 (GRCm39) missense probably benign
IGL02212:Ambra1 APN 2 91,747,706 (GRCm39) missense probably damaging 1.00
IGL02256:Ambra1 APN 2 91,599,399 (GRCm39) missense possibly damaging 0.95
IGL02319:Ambra1 APN 2 91,717,265 (GRCm39) missense probably damaging 1.00
IGL02502:Ambra1 APN 2 91,730,877 (GRCm39) missense probably damaging 1.00
IGL02961:Ambra1 APN 2 91,741,793 (GRCm39) missense possibly damaging 0.86
R0003:Ambra1 UTSW 2 91,741,773 (GRCm39) missense probably damaging 1.00
R0098:Ambra1 UTSW 2 91,598,056 (GRCm39) missense possibly damaging 0.66
R0173:Ambra1 UTSW 2 91,640,564 (GRCm39) splice site probably benign
R0414:Ambra1 UTSW 2 91,706,084 (GRCm39) missense possibly damaging 0.84
R0579:Ambra1 UTSW 2 91,654,810 (GRCm39) missense possibly damaging 0.66
R1212:Ambra1 UTSW 2 91,599,381 (GRCm39) missense possibly damaging 0.94
R1241:Ambra1 UTSW 2 91,601,241 (GRCm39) splice site probably benign
R1467:Ambra1 UTSW 2 91,716,048 (GRCm39) missense probably damaging 1.00
R1467:Ambra1 UTSW 2 91,716,048 (GRCm39) missense probably damaging 1.00
R1533:Ambra1 UTSW 2 91,717,210 (GRCm39) missense probably damaging 1.00
R1916:Ambra1 UTSW 2 91,741,806 (GRCm39) missense probably damaging 1.00
R2080:Ambra1 UTSW 2 91,716,064 (GRCm39) missense probably damaging 1.00
R2083:Ambra1 UTSW 2 91,596,945 (GRCm39) missense possibly damaging 0.83
R2112:Ambra1 UTSW 2 91,706,132 (GRCm39) missense probably damaging 1.00
R2255:Ambra1 UTSW 2 91,747,806 (GRCm39) missense probably damaging 1.00
R3407:Ambra1 UTSW 2 91,740,652 (GRCm39) missense probably damaging 1.00
R4111:Ambra1 UTSW 2 91,730,903 (GRCm39) missense probably damaging 1.00
R4792:Ambra1 UTSW 2 91,603,191 (GRCm39) missense possibly damaging 0.66
R4879:Ambra1 UTSW 2 91,603,039 (GRCm39) intron probably benign
R5007:Ambra1 UTSW 2 91,602,655 (GRCm39) missense possibly damaging 0.79
R5261:Ambra1 UTSW 2 91,715,951 (GRCm39) missense probably damaging 1.00
R6141:Ambra1 UTSW 2 91,706,099 (GRCm39) missense probably damaging 1.00
R6364:Ambra1 UTSW 2 91,603,661 (GRCm39) missense possibly damaging 0.66
R6413:Ambra1 UTSW 2 91,599,429 (GRCm39) missense possibly damaging 0.92
R6868:Ambra1 UTSW 2 91,747,878 (GRCm39) missense possibly damaging 0.83
R6888:Ambra1 UTSW 2 91,599,372 (GRCm39) missense probably damaging 1.00
R6964:Ambra1 UTSW 2 91,747,761 (GRCm39) nonsense probably null
R6970:Ambra1 UTSW 2 91,602,945 (GRCm39) intron probably benign
R6982:Ambra1 UTSW 2 91,747,818 (GRCm39) missense probably damaging 1.00
R7205:Ambra1 UTSW 2 91,598,103 (GRCm39) missense possibly damaging 0.46
R7458:Ambra1 UTSW 2 91,748,029 (GRCm39) missense probably benign 0.26
R7786:Ambra1 UTSW 2 91,598,141 (GRCm39) missense possibly damaging 0.46
R7812:Ambra1 UTSW 2 91,596,911 (GRCm39) start codon destroyed probably benign 0.00
R7825:Ambra1 UTSW 2 91,598,106 (GRCm39) missense probably damaging 1.00
R7860:Ambra1 UTSW 2 91,603,838 (GRCm39) missense probably benign 0.27
R8190:Ambra1 UTSW 2 91,602,697 (GRCm39) missense possibly damaging 0.95
R8779:Ambra1 UTSW 2 91,747,719 (GRCm39) missense probably benign 0.05
R9044:Ambra1 UTSW 2 91,740,434 (GRCm39) intron probably benign
R9062:Ambra1 UTSW 2 91,740,662 (GRCm39) missense possibly damaging 0.82
R9707:Ambra1 UTSW 2 91,640,476 (GRCm39) missense probably damaging 1.00
Z1177:Ambra1 UTSW 2 91,730,953 (GRCm39) missense possibly damaging 0.82
Z1177:Ambra1 UTSW 2 91,706,131 (GRCm39) missense probably damaging 0.97
Z1177:Ambra1 UTSW 2 91,599,344 (GRCm39) missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TGGCGAGTTCAATGCTCTATAG -3'
(R):5'- AATGCTCACCACTGCTACAG -3'

Sequencing Primer
(F):5'- CCATGGGCAAGTTGGCTTTTTC -3'
(R):5'- TGCTACAGAAACAGAGGCC -3'
Posted On 2015-11-11