Incidental Mutation 'R3732:Igsf10'
ID 356374
Institutional Source Beutler Lab
Gene Symbol Igsf10
Ensembl Gene ENSMUSG00000036334
Gene Name immunoglobulin superfamily, member 10
Synonyms 6530405F15Rik, CMF608, Adlican2
MMRRC Submission 040720-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.194) question?
Stock # R3732 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 59224156-59251815 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 59233135 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 1866 (F1866S)
Ref Sequence ENSEMBL: ENSMUSP00000141391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039419] [ENSMUST00000193455] [ENSMUST00000194546]
AlphaFold Q3V1M1
Predicted Effect probably benign
Transcript: ENSMUST00000039419
AA Change: F1866S

PolyPhen 2 Score 0.286 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000037246
Gene: ENSMUSG00000036334
AA Change: F1866S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRRNT 28 61 3.24e-4 SMART
LRR 57 79 9.24e1 SMART
LRR 80 103 2.02e-1 SMART
LRR 104 127 7.16e0 SMART
LRR_TYP 128 151 1.2e-3 SMART
LRR 152 175 1.25e-1 SMART
LRR 188 207 2.33e2 SMART
LRRCT 219 280 4.19e-4 SMART
IGc2 488 558 2.34e-4 SMART
IGc2 586 652 7.88e-11 SMART
low complexity region 917 930 N/A INTRINSIC
low complexity region 1175 1185 N/A INTRINSIC
low complexity region 1245 1263 N/A INTRINSIC
low complexity region 1311 1321 N/A INTRINSIC
low complexity region 1449 1465 N/A INTRINSIC
IGc2 1632 1701 7.69e-14 SMART
IGc2 1729 1798 5.07e-14 SMART
IGc2 1826 1895 2.19e-9 SMART
IGc2 1925 1994 4.59e-12 SMART
IGc2 2022 2097 1.33e-8 SMART
IGc2 2125 2191 2.96e-15 SMART
IGc2 2223 2291 2.03e-4 SMART
IGc2 2321 2389 9.99e-13 SMART
IGc2 2416 2484 3.03e-12 SMART
IGc2 2512 2583 7.76e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193455
AA Change: F1866S

PolyPhen 2 Score 0.286 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000141971
Gene: ENSMUSG00000036334
AA Change: F1866S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRRNT 28 61 3.24e-4 SMART
LRR 57 79 9.24e1 SMART
LRR 80 103 2.02e-1 SMART
LRR 104 127 7.16e0 SMART
LRR_TYP 128 151 1.2e-3 SMART
LRR 152 175 1.25e-1 SMART
LRR 188 207 2.33e2 SMART
LRRCT 219 280 4.19e-4 SMART
IGc2 488 558 2.34e-4 SMART
IGc2 586 652 7.88e-11 SMART
low complexity region 917 930 N/A INTRINSIC
low complexity region 1175 1185 N/A INTRINSIC
low complexity region 1245 1263 N/A INTRINSIC
low complexity region 1311 1321 N/A INTRINSIC
low complexity region 1449 1465 N/A INTRINSIC
IGc2 1632 1701 7.69e-14 SMART
IGc2 1729 1798 5.07e-14 SMART
IGc2 1826 1895 2.19e-9 SMART
IGc2 1925 1994 4.59e-12 SMART
IGc2 2022 2097 1.33e-8 SMART
IGc2 2125 2191 2.96e-15 SMART
IGc2 2223 2291 2.03e-4 SMART
IGc2 2321 2389 9.99e-13 SMART
IGc2 2416 2484 3.03e-12 SMART
IGc2 2512 2583 7.76e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000194546
AA Change: F1866S

PolyPhen 2 Score 0.286 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000141391
Gene: ENSMUSG00000036334
AA Change: F1866S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRRNT 28 61 3.24e-4 SMART
LRR 57 79 9.24e1 SMART
LRR 80 103 2.02e-1 SMART
LRR 104 127 7.16e0 SMART
LRR_TYP 128 151 1.2e-3 SMART
LRR 152 175 1.25e-1 SMART
LRR 188 207 2.33e2 SMART
LRRCT 219 280 4.19e-4 SMART
IGc2 488 558 2.34e-4 SMART
IGc2 586 652 7.88e-11 SMART
low complexity region 917 930 N/A INTRINSIC
low complexity region 1175 1185 N/A INTRINSIC
low complexity region 1245 1263 N/A INTRINSIC
low complexity region 1311 1321 N/A INTRINSIC
low complexity region 1449 1465 N/A INTRINSIC
IGc2 1632 1701 7.69e-14 SMART
IGc2 1729 1798 5.07e-14 SMART
IGc2 1826 1895 2.19e-9 SMART
IGc2 1925 1994 4.59e-12 SMART
IGc2 2022 2097 1.33e-8 SMART
IGc2 2125 2191 2.96e-15 SMART
IGc2 2223 2291 2.03e-4 SMART
IGc2 2321 2389 9.99e-13 SMART
IGc2 2416 2484 3.03e-12 SMART
IGc2 2512 2583 7.76e-10 SMART
Meta Mutation Damage Score 0.2960 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 93% (56/60)
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,684,980 (GRCm39) C172* probably null Het
Aacs C T 5: 125,583,326 (GRCm39) T294M probably damaging Het
Ablim1 A T 19: 57,037,892 (GRCm39) probably null Het
Adgrf4 C T 17: 42,983,472 (GRCm39) G70E probably damaging Het
Adgrl3 C A 5: 81,942,793 (GRCm39) H1474Q probably benign Het
Adgrv1 T C 13: 81,705,075 (GRCm39) I1578M probably damaging Het
Afg3l1 G A 8: 124,227,972 (GRCm39) G547D probably damaging Het
Ambra1 G A 2: 91,640,476 (GRCm39) R635H probably damaging Het
Araf TACACACACACACACACA TACACACACACACACA X: 20,716,465 (GRCm39) probably benign Het
Arhgef10l AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 4: 140,308,930 (GRCm39) probably benign Het
Bcl7b A G 5: 135,209,767 (GRCm39) T141A probably benign Het
Calm5 T A 13: 3,904,337 (GRCm39) N10K probably damaging Het
Camsap1 T C 2: 25,828,356 (GRCm39) R1123G probably damaging Het
Cfap97d1 C T 11: 101,879,278 (GRCm39) Q17* probably null Het
Chrna3 T C 9: 54,923,178 (GRCm39) K210R probably benign Het
Ciz1 A G 2: 32,257,495 (GRCm39) N180S possibly damaging Het
Cntnap3 G A 13: 64,888,813 (GRCm39) A1162V possibly damaging Het
Cox5b C T 1: 36,732,341 (GRCm39) P114L probably damaging Het
Cpsf2 T C 12: 101,953,567 (GRCm39) I199T probably damaging Het
Cyp2a4 A G 7: 26,012,252 (GRCm39) D345G probably damaging Het
Cyp2s1 C T 7: 25,503,379 (GRCm39) R424Q probably null Het
D1Pas1 C A 1: 186,700,294 (GRCm39) S74R probably benign Het
Ddx4 T A 13: 112,748,516 (GRCm39) I487F possibly damaging Het
Dnah5 A T 15: 28,409,268 (GRCm39) E3562V possibly damaging Het
Dpf3 T C 12: 83,316,281 (GRCm39) D330G possibly damaging Het
Edem1 T C 6: 108,818,582 (GRCm39) F197L probably damaging Het
Eeig1 G A 2: 32,456,304 (GRCm39) S322N probably benign Het
Ergic2 T C 6: 148,104,020 (GRCm39) D79G probably damaging Het
Espl1 A G 15: 102,221,424 (GRCm39) I944V probably damaging Het
Fam111a T C 19: 12,564,914 (GRCm39) L221P possibly damaging Het
Fat1 T C 8: 45,406,306 (GRCm39) V1019A possibly damaging Het
Fbxl21 T A 13: 56,674,830 (GRCm39) H60Q probably benign Het
Fbxw7 A C 3: 84,833,014 (GRCm39) K19Q possibly damaging Het
Gldn A G 9: 54,245,946 (GRCm39) K499R possibly damaging Het
Gria4 C T 9: 4,513,295 (GRCm39) M271I probably benign Het
Herc1 C T 9: 66,352,922 (GRCm39) T2136I probably damaging Het
Iqcg G T 16: 32,873,996 (GRCm39) probably benign Het
Itih2 A T 2: 10,110,481 (GRCm39) F537I probably benign Het
Itpr2 T C 6: 146,284,198 (GRCm39) D533G probably damaging Het
Kcnk15 A G 2: 163,695,733 (GRCm39) K22E probably benign Het
Lag3 A T 6: 124,887,103 (GRCm39) S155T probably benign Het
Lars1 T C 18: 42,345,667 (GRCm39) E1003G probably benign Het
Layn T A 9: 50,970,844 (GRCm39) N233I probably damaging Het
Ldhb-ps T G 19: 21,915,616 (GRCm39) noncoding transcript Het
Lgi1 T C 19: 38,294,694 (GRCm39) Y465H probably damaging Het
Lrig1 C T 6: 94,588,557 (GRCm39) A531T possibly damaging Het
Lrrtm4 A G 6: 79,996,638 (GRCm39) probably benign Het
Lsamp T A 16: 41,964,935 (GRCm39) L264H probably damaging Het
Mthfd2 T C 6: 83,290,457 (GRCm39) E39G probably damaging Het
Mtx2 C A 2: 74,677,606 (GRCm39) A22E probably damaging Het
Nipal3 T C 4: 135,191,157 (GRCm39) T325A probably damaging Het
Nlrp14 A T 7: 106,781,574 (GRCm39) Y257F probably benign Het
Ola1 G C 2: 72,987,204 (GRCm39) R143G probably damaging Het
Or14c44 T G 7: 86,061,841 (GRCm39) I90M probably damaging Het
Otog A G 7: 45,937,792 (GRCm39) T1834A probably benign Het
Oxr1 T C 15: 41,712,097 (GRCm39) I656T probably damaging Het
Panx1 GTTCTTCT GTTCT 9: 14,917,467 (GRCm39) probably benign Het
Pcdh18 T C 3: 49,709,240 (GRCm39) S692G probably benign Het
Pcdhga1 A G 18: 37,797,176 (GRCm39) T727A probably benign Het
Pde9a A G 17: 31,667,401 (GRCm39) E3G possibly damaging Het
Prl8a1 T C 13: 27,763,716 (GRCm39) E37G probably damaging Het
Rlf C T 4: 121,005,521 (GRCm39) G1153D probably benign Het
Robo2 A C 16: 73,717,635 (GRCm39) L1159W possibly damaging Het
Sfxn5 T C 6: 85,276,258 (GRCm39) probably benign Het
Siah2 A G 3: 58,583,671 (GRCm39) V205A probably damaging Het
Spindoc A C 19: 7,351,666 (GRCm39) L202R probably damaging Het
Spock3 T A 8: 63,798,733 (GRCm39) D251E probably damaging Het
Srp68 T A 11: 116,164,782 (GRCm39) K51* probably null Het
Ssbp2 T C 13: 91,672,726 (GRCm39) Y29H probably damaging Het
Sspo T C 6: 48,426,864 (GRCm39) V231A probably damaging Het
Stk4 T A 2: 163,930,828 (GRCm39) M143K probably benign Het
Tecta C T 9: 42,303,402 (GRCm39) V77M possibly damaging Het
Trpc3 A T 3: 36,692,708 (GRCm39) D761E probably benign Het
Tubb2a T C 13: 34,259,247 (GRCm39) E181G probably damaging Het
Ugcg C T 4: 59,207,798 (GRCm39) P46S probably benign Het
Ush2a C A 1: 188,676,957 (GRCm39) N4756K probably benign Het
Vmn2r129 G T 4: 156,686,692 (GRCm39) noncoding transcript Het
Wapl G A 14: 34,458,721 (GRCm39) V928I probably damaging Het
Zfand3 A G 17: 30,411,630 (GRCm39) K130R probably benign Het
Zfp934 A T 13: 62,665,599 (GRCm39) H347Q probably damaging Het
Other mutations in Igsf10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Igsf10 APN 3 59,238,960 (GRCm39) missense probably benign 0.03
IGL00790:Igsf10 APN 3 59,226,938 (GRCm39) missense probably damaging 1.00
IGL00916:Igsf10 APN 3 59,238,548 (GRCm39) missense probably damaging 0.97
IGL00928:Igsf10 APN 3 59,238,018 (GRCm39) missense probably benign 0.00
IGL01066:Igsf10 APN 3 59,235,203 (GRCm39) critical splice donor site probably null
IGL01107:Igsf10 APN 3 59,238,945 (GRCm39) missense probably damaging 1.00
IGL01420:Igsf10 APN 3 59,227,071 (GRCm39) missense probably benign 0.02
IGL01533:Igsf10 APN 3 59,226,651 (GRCm39) missense probably damaging 0.98
IGL01537:Igsf10 APN 3 59,237,452 (GRCm39) missense probably benign 0.00
IGL01676:Igsf10 APN 3 59,236,756 (GRCm39) missense probably benign 0.17
IGL01676:Igsf10 APN 3 59,233,432 (GRCm39) missense probably benign 0.06
IGL01960:Igsf10 APN 3 59,226,158 (GRCm39) missense probably benign 0.00
IGL02123:Igsf10 APN 3 59,226,081 (GRCm39) missense probably damaging 0.97
IGL02198:Igsf10 APN 3 59,233,399 (GRCm39) missense possibly damaging 0.95
IGL02268:Igsf10 APN 3 59,238,573 (GRCm39) nonsense probably null
IGL02313:Igsf10 APN 3 59,238,111 (GRCm39) missense probably benign 0.01
IGL02368:Igsf10 APN 3 59,235,652 (GRCm39) missense probably benign
IGL02494:Igsf10 APN 3 59,235,427 (GRCm39) missense probably damaging 0.98
IGL02549:Igsf10 APN 3 59,236,662 (GRCm39) missense probably benign 0.03
IGL02616:Igsf10 APN 3 59,226,027 (GRCm39) missense probably benign 0.06
IGL02957:Igsf10 APN 3 59,238,285 (GRCm39) missense probably damaging 1.00
IGL03067:Igsf10 APN 3 59,226,339 (GRCm39) missense probably benign 0.25
IGL03104:Igsf10 APN 3 59,226,905 (GRCm39) missense probably damaging 1.00
IGL03124:Igsf10 APN 3 59,227,086 (GRCm39) missense probably benign 0.01
IGL03212:Igsf10 APN 3 59,235,586 (GRCm39) missense probably benign 0.09
IGL03347:Igsf10 APN 3 59,239,321 (GRCm39) missense possibly damaging 0.94
IGL03357:Igsf10 APN 3 59,243,632 (GRCm39) missense probably benign 0.35
F6893:Igsf10 UTSW 3 59,238,481 (GRCm39) missense probably damaging 1.00
FR4449:Igsf10 UTSW 3 59,226,531 (GRCm39) missense probably damaging 1.00
PIT1430001:Igsf10 UTSW 3 59,235,579 (GRCm39) missense probably benign 0.06
PIT4402001:Igsf10 UTSW 3 59,233,000 (GRCm39) missense probably benign 0.00
PIT4810001:Igsf10 UTSW 3 59,225,903 (GRCm39) missense probably damaging 1.00
R0068:Igsf10 UTSW 3 59,238,045 (GRCm39) missense probably damaging 0.98
R0095:Igsf10 UTSW 3 59,238,617 (GRCm39) nonsense probably null
R0095:Igsf10 UTSW 3 59,238,617 (GRCm39) nonsense probably null
R0112:Igsf10 UTSW 3 59,233,429 (GRCm39) missense probably benign 0.00
R0141:Igsf10 UTSW 3 59,238,253 (GRCm39) missense probably damaging 1.00
R0538:Igsf10 UTSW 3 59,227,527 (GRCm39) missense probably damaging 0.99
R0551:Igsf10 UTSW 3 59,236,089 (GRCm39) missense probably benign 0.01
R0556:Igsf10 UTSW 3 59,236,296 (GRCm39) missense probably benign 0.02
R0582:Igsf10 UTSW 3 59,227,188 (GRCm39) missense probably benign 0.00
R0630:Igsf10 UTSW 3 59,233,483 (GRCm39) missense probably damaging 1.00
R0675:Igsf10 UTSW 3 59,236,015 (GRCm39) missense probably benign 0.14
R0948:Igsf10 UTSW 3 59,238,525 (GRCm39) missense probably damaging 1.00
R1252:Igsf10 UTSW 3 59,239,269 (GRCm39) missense probably benign 0.03
R1412:Igsf10 UTSW 3 59,235,196 (GRCm39) splice site probably benign
R1473:Igsf10 UTSW 3 59,226,188 (GRCm39) missense probably damaging 1.00
R1585:Igsf10 UTSW 3 59,237,838 (GRCm39) missense probably damaging 1.00
R1650:Igsf10 UTSW 3 59,233,583 (GRCm39) missense probably damaging 1.00
R1660:Igsf10 UTSW 3 59,238,706 (GRCm39) missense probably damaging 1.00
R1671:Igsf10 UTSW 3 59,235,921 (GRCm39) nonsense probably null
R1748:Igsf10 UTSW 3 59,226,514 (GRCm39) missense probably damaging 1.00
R1758:Igsf10 UTSW 3 59,236,617 (GRCm39) missense probably benign 0.09
R1856:Igsf10 UTSW 3 59,238,693 (GRCm39) missense possibly damaging 0.63
R1912:Igsf10 UTSW 3 59,236,993 (GRCm39) missense probably benign 0.40
R2148:Igsf10 UTSW 3 59,243,998 (GRCm39) missense possibly damaging 0.77
R2155:Igsf10 UTSW 3 59,239,101 (GRCm39) missense probably damaging 1.00
R2509:Igsf10 UTSW 3 59,239,287 (GRCm39) missense probably damaging 1.00
R2511:Igsf10 UTSW 3 59,239,287 (GRCm39) missense probably damaging 1.00
R2680:Igsf10 UTSW 3 59,232,875 (GRCm39) missense probably benign 0.14
R2913:Igsf10 UTSW 3 59,239,157 (GRCm39) missense possibly damaging 0.70
R2927:Igsf10 UTSW 3 59,236,848 (GRCm39) missense probably benign
R3547:Igsf10 UTSW 3 59,243,935 (GRCm39) missense probably damaging 1.00
R3547:Igsf10 UTSW 3 59,237,962 (GRCm39) missense probably benign 0.02
R3548:Igsf10 UTSW 3 59,243,935 (GRCm39) missense probably damaging 1.00
R3620:Igsf10 UTSW 3 59,243,752 (GRCm39) missense probably damaging 1.00
R3743:Igsf10 UTSW 3 59,233,546 (GRCm39) missense possibly damaging 0.69
R3973:Igsf10 UTSW 3 59,239,345 (GRCm39) missense probably damaging 1.00
R4005:Igsf10 UTSW 3 59,235,981 (GRCm39) missense probably benign 0.00
R4184:Igsf10 UTSW 3 59,227,152 (GRCm39) missense probably damaging 1.00
R4302:Igsf10 UTSW 3 59,226,171 (GRCm39) missense probably damaging 1.00
R4404:Igsf10 UTSW 3 59,236,972 (GRCm39) missense probably benign 0.04
R4575:Igsf10 UTSW 3 59,237,521 (GRCm39) missense probably benign
R4676:Igsf10 UTSW 3 59,233,370 (GRCm39) missense probably benign 0.23
R4700:Igsf10 UTSW 3 59,227,751 (GRCm39) missense probably damaging 0.99
R4765:Igsf10 UTSW 3 59,237,126 (GRCm39) missense probably benign 0.01
R4986:Igsf10 UTSW 3 59,236,027 (GRCm39) missense probably benign 0.24
R5012:Igsf10 UTSW 3 59,226,143 (GRCm39) missense probably damaging 1.00
R5070:Igsf10 UTSW 3 59,235,714 (GRCm39) missense probably benign 0.02
R5083:Igsf10 UTSW 3 59,233,694 (GRCm39) missense probably damaging 1.00
R5336:Igsf10 UTSW 3 59,227,553 (GRCm39) missense probably damaging 1.00
R5462:Igsf10 UTSW 3 59,233,175 (GRCm39) missense probably damaging 1.00
R5648:Igsf10 UTSW 3 59,235,574 (GRCm39) missense probably benign 0.01
R5810:Igsf10 UTSW 3 59,226,492 (GRCm39) missense probably damaging 1.00
R5871:Igsf10 UTSW 3 59,237,832 (GRCm39) missense possibly damaging 0.83
R5880:Igsf10 UTSW 3 59,238,252 (GRCm39) missense probably damaging 1.00
R5935:Igsf10 UTSW 3 59,235,578 (GRCm39) missense probably benign 0.12
R5979:Igsf10 UTSW 3 59,243,894 (GRCm39) missense probably damaging 1.00
R6145:Igsf10 UTSW 3 59,239,077 (GRCm39) missense possibly damaging 0.83
R6222:Igsf10 UTSW 3 59,226,336 (GRCm39) missense possibly damaging 0.90
R6224:Igsf10 UTSW 3 59,232,931 (GRCm39) missense probably damaging 1.00
R6264:Igsf10 UTSW 3 59,235,928 (GRCm39) missense possibly damaging 0.88
R6283:Igsf10 UTSW 3 59,226,870 (GRCm39) missense probably damaging 1.00
R6336:Igsf10 UTSW 3 59,237,760 (GRCm39) missense probably benign 0.00
R6490:Igsf10 UTSW 3 59,236,992 (GRCm39) missense probably benign 0.06
R6785:Igsf10 UTSW 3 59,226,665 (GRCm39) missense probably damaging 1.00
R6873:Igsf10 UTSW 3 59,235,865 (GRCm39) missense probably benign
R6889:Igsf10 UTSW 3 59,239,354 (GRCm39) missense probably benign
R7024:Igsf10 UTSW 3 59,239,122 (GRCm39) missense probably benign 0.00
R7056:Igsf10 UTSW 3 59,238,501 (GRCm39) missense probably damaging 1.00
R7128:Igsf10 UTSW 3 59,236,326 (GRCm39) missense probably benign
R7251:Igsf10 UTSW 3 59,226,875 (GRCm39) missense probably damaging 1.00
R7313:Igsf10 UTSW 3 59,236,837 (GRCm39) missense probably benign 0.05
R7340:Igsf10 UTSW 3 59,233,189 (GRCm39) missense probably damaging 1.00
R7447:Igsf10 UTSW 3 59,239,222 (GRCm39) missense probably benign 0.39
R7506:Igsf10 UTSW 3 59,226,775 (GRCm39) missense probably damaging 1.00
R7678:Igsf10 UTSW 3 59,226,761 (GRCm39) missense possibly damaging 0.81
R7695:Igsf10 UTSW 3 59,233,612 (GRCm39) missense probably damaging 1.00
R7709:Igsf10 UTSW 3 59,238,964 (GRCm39) missense probably damaging 0.96
R7749:Igsf10 UTSW 3 59,236,549 (GRCm39) missense possibly damaging 0.88
R7808:Igsf10 UTSW 3 59,235,489 (GRCm39) missense probably benign 0.00
R7850:Igsf10 UTSW 3 59,227,053 (GRCm39) missense probably benign 0.33
R7879:Igsf10 UTSW 3 59,238,145 (GRCm39) missense probably damaging 1.00
R7886:Igsf10 UTSW 3 59,235,748 (GRCm39) missense probably benign 0.01
R7891:Igsf10 UTSW 3 59,235,832 (GRCm39) nonsense probably null
R7946:Igsf10 UTSW 3 59,227,125 (GRCm39) missense possibly damaging 0.69
R7948:Igsf10 UTSW 3 59,239,279 (GRCm39) missense probably benign 0.02
R8004:Igsf10 UTSW 3 59,237,130 (GRCm39) missense probably benign 0.01
R8096:Igsf10 UTSW 3 59,236,380 (GRCm39) missense probably damaging 0.98
R8141:Igsf10 UTSW 3 59,237,949 (GRCm39) missense probably damaging 0.96
R8183:Igsf10 UTSW 3 59,238,036 (GRCm39) missense probably benign 0.04
R8203:Igsf10 UTSW 3 59,236,254 (GRCm39) missense probably benign 0.11
R8325:Igsf10 UTSW 3 59,225,954 (GRCm39) missense probably damaging 0.96
R8350:Igsf10 UTSW 3 59,238,949 (GRCm39) missense probably damaging 1.00
R8387:Igsf10 UTSW 3 59,236,564 (GRCm39) missense probably damaging 1.00
R8488:Igsf10 UTSW 3 59,227,431 (GRCm39) missense probably damaging 1.00
R8697:Igsf10 UTSW 3 59,226,308 (GRCm39) missense probably benign 0.02
R8786:Igsf10 UTSW 3 59,238,063 (GRCm39) missense probably benign 0.25
R8804:Igsf10 UTSW 3 59,243,876 (GRCm39) missense probably damaging 1.00
R8886:Igsf10 UTSW 3 59,237,410 (GRCm39) missense probably benign 0.00
R8902:Igsf10 UTSW 3 59,243,633 (GRCm39) missense probably benign 0.00
R8906:Igsf10 UTSW 3 59,233,739 (GRCm39) missense probably benign 0.01
R8917:Igsf10 UTSW 3 59,226,888 (GRCm39) missense possibly damaging 0.69
R9051:Igsf10 UTSW 3 59,236,668 (GRCm39) missense probably benign 0.00
R9178:Igsf10 UTSW 3 59,233,480 (GRCm39) missense possibly damaging 0.69
R9228:Igsf10 UTSW 3 59,243,843 (GRCm39) missense probably damaging 1.00
R9230:Igsf10 UTSW 3 59,243,843 (GRCm39) missense probably damaging 1.00
R9231:Igsf10 UTSW 3 59,243,843 (GRCm39) missense probably damaging 1.00
R9232:Igsf10 UTSW 3 59,243,843 (GRCm39) missense probably damaging 1.00
R9417:Igsf10 UTSW 3 59,236,526 (GRCm39) missense possibly damaging 0.94
R9609:Igsf10 UTSW 3 59,226,869 (GRCm39) missense probably damaging 1.00
R9631:Igsf10 UTSW 3 59,237,904 (GRCm39) missense probably damaging 1.00
R9689:Igsf10 UTSW 3 59,233,624 (GRCm39) missense probably damaging 1.00
R9762:Igsf10 UTSW 3 59,237,106 (GRCm39) missense probably damaging 1.00
R9770:Igsf10 UTSW 3 59,227,199 (GRCm39) missense probably benign 0.07
R9798:Igsf10 UTSW 3 59,239,126 (GRCm39) missense probably damaging 1.00
Z1088:Igsf10 UTSW 3 59,237,359 (GRCm39) missense possibly damaging 0.59
Z1177:Igsf10 UTSW 3 59,237,026 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTCTGTCCATTTCTGCGAGG -3'
(R):5'- GTGTGTAGCCAACAACCCATC -3'

Sequencing Primer
(F):5'- AGGCAGTTTCTATCCTGGGAAC -3'
(R):5'- CATCTGGCCAGGATTCACTG -3'
Posted On 2015-11-11