Incidental Mutation 'R3732:Rlf'
ID356375
Institutional Source Beutler Lab
Gene Symbol Rlf
Ensembl Gene ENSMUSG00000049878
Gene Namerearranged L-myc fusion sequence
SynonymsMommeD8, 9230110M18Rik
MMRRC Submission 040720-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3732 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location121145373-121215084 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 121148324 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 1153 (G1153D)
Ref Sequence ENSEMBL: ENSMUSP00000127068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056635] [ENSMUST00000168615]
Predicted Effect probably benign
Transcript: ENSMUST00000056635
AA Change: G1263D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000050825
Gene: ENSMUSG00000049878
AA Change: G1263D

DomainStartEndE-ValueType
low complexity region 2 31 N/A INTRINSIC
low complexity region 129 149 N/A INTRINSIC
low complexity region 298 309 N/A INTRINSIC
ZnF_C2H2 554 575 1.27e2 SMART
ZnF_C2H2 581 603 1.08e-1 SMART
ZnF_C2H2 667 692 5.42e-2 SMART
ZnF_C2H2 710 732 8.09e-1 SMART
ZnF_C2H2 738 762 3.99e0 SMART
ZnF_C2H2 767 791 3.16e-3 SMART
ZnF_C2H2 797 821 1.18e-2 SMART
low complexity region 885 909 N/A INTRINSIC
ZnF_C2H2 949 974 2.57e-3 SMART
low complexity region 1055 1066 N/A INTRINSIC
ZnF_C2H2 1122 1147 5.9e-3 SMART
ZnF_C2H2 1167 1190 4.17e-3 SMART
low complexity region 1259 1285 N/A INTRINSIC
ZnF_C2H2 1303 1328 5.06e-2 SMART
ZnF_C2H2 1355 1380 6.57e-1 SMART
ZnF_C2H2 1400 1425 3.83e-2 SMART
ZnF_C2H2 1437 1462 8.81e-2 SMART
low complexity region 1488 1514 N/A INTRINSIC
low complexity region 1521 1533 N/A INTRINSIC
ZnF_C2H2 1556 1581 4.81e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168615
AA Change: G1153D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127068
Gene: ENSMUSG00000049878
AA Change: G1153D

DomainStartEndE-ValueType
low complexity region 22 39 N/A INTRINSIC
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 444 465 1.27e2 SMART
ZnF_C2H2 471 493 1.08e-1 SMART
ZnF_C2H2 557 582 5.42e-2 SMART
ZnF_C2H2 600 622 8.09e-1 SMART
ZnF_C2H2 628 652 3.99e0 SMART
ZnF_C2H2 657 681 3.16e-3 SMART
ZnF_C2H2 687 711 1.18e-2 SMART
low complexity region 775 799 N/A INTRINSIC
ZnF_C2H2 839 864 2.57e-3 SMART
low complexity region 945 956 N/A INTRINSIC
ZnF_C2H2 1012 1037 5.9e-3 SMART
ZnF_C2H2 1057 1080 4.17e-3 SMART
low complexity region 1149 1175 N/A INTRINSIC
ZnF_C2H2 1193 1218 5.06e-2 SMART
ZnF_C2H2 1245 1270 6.57e-1 SMART
ZnF_C2H2 1290 1315 3.83e-2 SMART
ZnF_C2H2 1327 1352 8.81e-2 SMART
low complexity region 1378 1404 N/A INTRINSIC
low complexity region 1411 1423 N/A INTRINSIC
ZnF_C2H2 1446 1471 4.81e0 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 93% (56/60)
MGI Phenotype PHENOTYPE: Mice homozygous for a hypomorphic ENU-induced allele exhibit postnatal lethality. Only a few mice survive to weaning age exhibiting a decreased body size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik C T 11: 101,988,452 Q17* probably null Het
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Aacs C T 5: 125,506,262 T294M probably damaging Het
Ablim1 A T 19: 57,049,460 probably null Het
Adgrf4 C T 17: 42,672,581 G70E probably damaging Het
Adgrl3 C A 5: 81,794,946 H1474Q probably benign Het
Adgrv1 T C 13: 81,556,956 I1578M probably damaging Het
Afg3l1 G A 8: 123,501,233 G547D probably damaging Het
Ambra1 G A 2: 91,810,131 R635H probably damaging Het
Araf TACACACACACACACACA TACACACACACACACA X: 20,850,226 probably benign Het
Arhgef10l AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 4: 140,581,619 probably benign Het
Bcl7b A G 5: 135,180,913 T141A probably benign Het
Calm5 T A 13: 3,854,337 N10K probably damaging Het
Camsap1 T C 2: 25,938,344 R1123G probably damaging Het
Chrna3 T C 9: 55,015,894 K210R probably benign Het
Ciz1 A G 2: 32,367,483 N180S possibly damaging Het
Cntnap3 G A 13: 64,740,999 A1162V possibly damaging Het
Cox5b C T 1: 36,693,260 P114L probably damaging Het
Cpsf2 T C 12: 101,987,308 I199T probably damaging Het
Cyp2a4 A G 7: 26,312,827 D345G probably damaging Het
Cyp2s1 C T 7: 25,803,954 R424Q probably null Het
D1Pas1 C A 1: 186,968,097 S74R probably benign Het
Ddx4 T A 13: 112,611,982 I487F possibly damaging Het
Dnah5 A T 15: 28,409,122 E3562V possibly damaging Het
Dpf3 T C 12: 83,269,507 D330G possibly damaging Het
Edem1 T C 6: 108,841,621 F197L probably damaging Het
Ergic2 T C 6: 148,202,522 D79G probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fam102a G A 2: 32,566,292 S322N probably benign Het
Fam111a T C 19: 12,587,550 L221P possibly damaging Het
Fat1 T C 8: 44,953,269 V1019A possibly damaging Het
Fbxl21 T A 13: 56,527,017 H60Q probably benign Het
Fbxw7 A C 3: 84,925,707 K19Q possibly damaging Het
Gldn A G 9: 54,338,662 K499R possibly damaging Het
Gm5514 T G 19: 21,938,252 noncoding transcript Het
Gria4 C T 9: 4,513,295 M271I probably benign Het
Herc1 C T 9: 66,445,640 T2136I probably damaging Het
Igsf10 A G 3: 59,325,714 F1866S probably benign Het
Iqcg G T 16: 33,053,626 probably benign Het
Itih2 A T 2: 10,105,670 F537I probably benign Het
Itpr2 T C 6: 146,382,700 D533G probably damaging Het
Kcnk15 A G 2: 163,853,813 K22E probably benign Het
Lag3 A T 6: 124,910,140 S155T probably benign Het
Lars T C 18: 42,212,602 E1003G probably benign Het
Layn T A 9: 51,059,544 N233I probably damaging Het
Lgi1 T C 19: 38,306,246 Y465H probably damaging Het
Lrig1 C T 6: 94,611,576 A531T possibly damaging Het
Lrrtm4 A G 6: 80,019,655 probably benign Het
Lsamp T A 16: 42,144,572 L264H probably damaging Het
Mthfd2 T C 6: 83,313,475 E39G probably damaging Het
Mtx2 C A 2: 74,847,262 A22E probably damaging Het
Nipal3 T C 4: 135,463,846 T325A probably damaging Het
Nlrp14 A T 7: 107,182,367 Y257F probably benign Het
Ola1 G C 2: 73,156,860 R143G probably damaging Het
Olfr301 T G 7: 86,412,633 I90M probably damaging Het
Otog A G 7: 46,288,368 T1834A probably benign Het
Oxr1 T C 15: 41,848,701 I656T probably damaging Het
Panx1 GTTCTTCT GTTCT 9: 15,006,171 probably benign Het
Pcdh18 T C 3: 49,754,791 S692G probably benign Het
Pcdhga1 A G 18: 37,664,123 T727A probably benign Het
Pde9a A G 17: 31,448,427 E3G possibly damaging Het
Prl8a1 T C 13: 27,579,733 E37G probably damaging Het
Robo2 A C 16: 73,920,747 L1159W possibly damaging Het
Sfxn5 T C 6: 85,299,276 probably benign Het
Siah2 A G 3: 58,676,250 V205A probably damaging Het
Spindoc A C 19: 7,374,301 L202R probably damaging Het
Spock3 T A 8: 63,345,699 D251E probably damaging Het
Srp68 T A 11: 116,273,956 K51* probably null Het
Ssbp2 T C 13: 91,524,607 Y29H probably damaging Het
Sspo T C 6: 48,449,930 V231A probably damaging Het
Stk4 T A 2: 164,088,908 M143K probably benign Het
Tecta C T 9: 42,392,106 V77M possibly damaging Het
Trpc3 A T 3: 36,638,559 D761E probably benign Het
Tubb2a T C 13: 34,075,264 E181G probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ush2a C A 1: 188,944,760 N4756K probably benign Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Wapl G A 14: 34,736,764 V928I probably damaging Het
Zfand3 A G 17: 30,192,656 K130R probably benign Het
Zfp934 A T 13: 62,517,785 H347Q probably damaging Het
Other mutations in Rlf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Rlf APN 4 121170686 missense possibly damaging 0.89
IGL00558:Rlf APN 4 121150973 missense probably damaging 1.00
IGL00990:Rlf APN 4 121148339 missense possibly damaging 0.87
IGL01625:Rlf APN 4 121188260 missense possibly damaging 0.68
IGL01921:Rlf APN 4 121146746 missense probably damaging 1.00
IGL01986:Rlf APN 4 121148106 missense probably damaging 1.00
IGL02232:Rlf APN 4 121182614 missense probably benign 0.21
IGL02586:Rlf APN 4 121150064 missense probably damaging 1.00
IGL03177:Rlf APN 4 121148079 nonsense probably null
IGL03233:Rlf APN 4 121182600 splice site probably benign
IGL03293:Rlf APN 4 121148330 missense probably benign 0.18
Brady UTSW 4 121148553 nonsense probably null
bunch UTSW 4 121154975 missense probably damaging 1.00
transsubstantiation UTSW 4 121148291 missense probably benign 0.10
wafer UTSW 4 121150532 missense probably benign 0.00
Wine UTSW 4 121148172 missense probably damaging 1.00
PIT4651001:Rlf UTSW 4 121150313 missense probably damaging 0.98
R0019:Rlf UTSW 4 121146572 missense possibly damaging 0.46
R0019:Rlf UTSW 4 121146572 missense possibly damaging 0.46
R0039:Rlf UTSW 4 121146842 missense possibly damaging 0.90
R0041:Rlf UTSW 4 121149929 missense probably damaging 1.00
R0041:Rlf UTSW 4 121149929 missense probably damaging 1.00
R0590:Rlf UTSW 4 121170833 splice site probably benign
R1562:Rlf UTSW 4 121150391 missense possibly damaging 0.47
R1585:Rlf UTSW 4 121148291 missense probably benign 0.10
R1627:Rlf UTSW 4 121150000 missense probably benign 0.34
R1709:Rlf UTSW 4 121149823 missense probably benign 0.00
R1968:Rlf UTSW 4 121148420 missense probably damaging 1.00
R1982:Rlf UTSW 4 121150112 missense probably damaging 1.00
R3120:Rlf UTSW 4 121149483 missense probably benign 0.01
R3155:Rlf UTSW 4 121149332 missense probably damaging 1.00
R3162:Rlf UTSW 4 121148847 missense probably damaging 1.00
R3162:Rlf UTSW 4 121148847 missense probably damaging 1.00
R3429:Rlf UTSW 4 121150532 missense probably benign 0.00
R3430:Rlf UTSW 4 121150532 missense probably benign 0.00
R3700:Rlf UTSW 4 121150863 missense possibly damaging 0.77
R3909:Rlf UTSW 4 121149032 missense probably benign 0.00
R4033:Rlf UTSW 4 121147343 missense probably damaging 1.00
R4350:Rlf UTSW 4 121149096 missense probably benign 0.16
R4654:Rlf UTSW 4 121150601 missense probably benign 0.28
R4976:Rlf UTSW 4 121147455 missense probably damaging 0.98
R5060:Rlf UTSW 4 121146866 missense probably benign 0.00
R5105:Rlf UTSW 4 121150367 missense probably damaging 1.00
R5119:Rlf UTSW 4 121147455 missense probably damaging 0.98
R5150:Rlf UTSW 4 121148172 missense probably damaging 1.00
R5198:Rlf UTSW 4 121148553 nonsense probably null
R5214:Rlf UTSW 4 121150700 missense probably damaging 1.00
R6084:Rlf UTSW 4 121149215 missense possibly damaging 0.95
R6131:Rlf UTSW 4 121154975 missense probably damaging 1.00
R6188:Rlf UTSW 4 121170766 missense probably damaging 1.00
R6313:Rlf UTSW 4 121148610 missense probably damaging 0.99
R6332:Rlf UTSW 4 121148822 missense possibly damaging 0.75
R6341:Rlf UTSW 4 121149360 nonsense probably null
R6413:Rlf UTSW 4 121147325 missense probably damaging 1.00
R6683:Rlf UTSW 4 121147926 missense probably damaging 1.00
R7066:Rlf UTSW 4 121148787 missense probably benign
R7413:Rlf UTSW 4 121150100 missense probably damaging 1.00
R7640:Rlf UTSW 4 121146801 missense possibly damaging 0.96
R7641:Rlf UTSW 4 121159196 missense probably damaging 1.00
R7855:Rlf UTSW 4 121182691 missense possibly damaging 0.93
R7938:Rlf UTSW 4 121182691 missense possibly damaging 0.93
R8127:Rlf UTSW 4 121147896 missense possibly damaging 0.89
R8146:Rlf UTSW 4 121147232 missense probably benign 0.16
R8182:Rlf UTSW 4 121150905 missense possibly damaging 0.94
Z1176:Rlf UTSW 4 121150428 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGAATCAGGCCTTTTAGATTG -3'
(R):5'- ACATCAAATTGGCAGTGACAGG -3'

Sequencing Primer
(F):5'- CAGGCCTTTTAGATTGGTAAATGAAG -3'
(R):5'- GGGCAACTCACAGACTGTTAGAC -3'
Posted On2015-11-11