Mutagenetix > Incidental Mutation

Incidental Mutation 'R3732:Rlf'

356375

Institutional Source

Beutler Lab

Gene Symbol

Rlf

Ensembl Gene

ENSMUSG00000049878

Gene Name

rearranged L-myc fusion sequence

Synonyms

MommeD8, 9230110M18Rik

MMRRC Submission

040720-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3732 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

121145373-121215084 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 121148324 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 1153 (G1153D)

Ref Sequence

ENSEMBL: ENSMUSP00000127068 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056635] [ENSMUST00000168615]

AlphaFold

A2A7F4

Predicted Effect

probably benign
Transcript: ENSMUST00000056635
AA Change: G1263D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000050825
Gene: ENSMUSG00000049878
AA Change: G1263D

Domain	Start	End	E-Value	Type
low complexity region	2	31	N/A	INTRINSIC
low complexity region	129	149	N/A	INTRINSIC
low complexity region	298	309	N/A	INTRINSIC
ZnF_C2H2	554	575	1.27e2	SMART
ZnF_C2H2	581	603	1.08e-1	SMART
ZnF_C2H2	667	692	5.42e-2	SMART
ZnF_C2H2	710	732	8.09e-1	SMART
ZnF_C2H2	738	762	3.99e0	SMART
ZnF_C2H2	767	791	3.16e-3	SMART
ZnF_C2H2	797	821	1.18e-2	SMART
low complexity region	885	909	N/A	INTRINSIC
ZnF_C2H2	949	974	2.57e-3	SMART
low complexity region	1055	1066	N/A	INTRINSIC
ZnF_C2H2	1122	1147	5.9e-3	SMART
ZnF_C2H2	1167	1190	4.17e-3	SMART
low complexity region	1259	1285	N/A	INTRINSIC
ZnF_C2H2	1303	1328	5.06e-2	SMART
ZnF_C2H2	1355	1380	6.57e-1	SMART
ZnF_C2H2	1400	1425	3.83e-2	SMART
ZnF_C2H2	1437	1462	8.81e-2	SMART
low complexity region	1488	1514	N/A	INTRINSIC
low complexity region	1521	1533	N/A	INTRINSIC
ZnF_C2H2	1556	1581	4.81e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000168615
AA Change: G1153D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000127068
Gene: ENSMUSG00000049878
AA Change: G1153D

Domain	Start	End	E-Value	Type
low complexity region	22	39	N/A	INTRINSIC
low complexity region	188	199	N/A	INTRINSIC
ZnF_C2H2	444	465	1.27e2	SMART
ZnF_C2H2	471	493	1.08e-1	SMART
ZnF_C2H2	557	582	5.42e-2	SMART
ZnF_C2H2	600	622	8.09e-1	SMART
ZnF_C2H2	628	652	3.99e0	SMART
ZnF_C2H2	657	681	3.16e-3	SMART
ZnF_C2H2	687	711	1.18e-2	SMART
low complexity region	775	799	N/A	INTRINSIC
ZnF_C2H2	839	864	2.57e-3	SMART
low complexity region	945	956	N/A	INTRINSIC
ZnF_C2H2	1012	1037	5.9e-3	SMART
ZnF_C2H2	1057	1080	4.17e-3	SMART
low complexity region	1149	1175	N/A	INTRINSIC
ZnF_C2H2	1193	1218	5.06e-2	SMART
ZnF_C2H2	1245	1270	6.57e-1	SMART
ZnF_C2H2	1290	1315	3.83e-2	SMART
ZnF_C2H2	1327	1352	8.81e-2	SMART
low complexity region	1378	1404	N/A	INTRINSIC
low complexity region	1411	1423	N/A	INTRINSIC
ZnF_C2H2	1446	1471	4.81e0	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.6%

Validation Efficiency

93% (56/60)

MGI Phenotype

PHENOTYPE: Mice homozygous for a hypomorphic ENU-induced allele exhibit postnatal lethality. Only a few mice survive to weaning age exhibiting a decreased body size. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006E09Rik	C	T	11: 101,988,452	Q17*	probably null	Het
1700012B07Rik	G	T	11: 109,794,154	C172*	probably null	Het
Aacs	C	T	5: 125,506,262	T294M	probably damaging	Het
Ablim1	A	T	19: 57,049,460		probably null	Het
Adgrf4	C	T	17: 42,672,581	G70E	probably damaging	Het
Adgrl3	C	A	5: 81,794,946	H1474Q	probably benign	Het
Adgrv1	T	C	13: 81,556,956	I1578M	probably damaging	Het
Afg3l1	G	A	8: 123,501,233	G547D	probably damaging	Het
Ambra1	G	A	2: 91,810,131	R635H	probably damaging	Het
Araf	TACACACACACACACACA	TACACACACACACACA	X: 20,850,226		probably benign	Het
Arhgef10l	AGAGGAGGAGGAGGAGGA	AGAGGAGGAGGAGGA	4: 140,581,619		probably benign	Het
Bcl7b	A	G	5: 135,180,913	T141A	probably benign	Het
Calm5	T	A	13: 3,854,337	N10K	probably damaging	Het
Camsap1	T	C	2: 25,938,344	R1123G	probably damaging	Het
Chrna3	T	C	9: 55,015,894	K210R	probably benign	Het
Ciz1	A	G	2: 32,367,483	N180S	possibly damaging	Het
Cntnap3	G	A	13: 64,740,999	A1162V	possibly damaging	Het
Cox5b	C	T	1: 36,693,260	P114L	probably damaging	Het
Cpsf2	T	C	12: 101,987,308	I199T	probably damaging	Het
Cyp2a4	A	G	7: 26,312,827	D345G	probably damaging	Het
Cyp2s1	C	T	7: 25,803,954	R424Q	probably null	Het
D1Pas1	C	A	1: 186,968,097	S74R	probably benign	Het
Ddx4	T	A	13: 112,611,982	I487F	possibly damaging	Het
Dnah5	A	T	15: 28,409,122	E3562V	possibly damaging	Het
Dpf3	T	C	12: 83,269,507	D330G	possibly damaging	Het
Edem1	T	C	6: 108,841,621	F197L	probably damaging	Het
Ergic2	T	C	6: 148,202,522	D79G	probably damaging	Het
Espl1	A	G	15: 102,312,989	I944V	probably damaging	Het
Fam102a	G	A	2: 32,566,292	S322N	probably benign	Het
Fam111a	T	C	19: 12,587,550	L221P	possibly damaging	Het
Fat1	T	C	8: 44,953,269	V1019A	possibly damaging	Het
Fbxl21	T	A	13: 56,527,017	H60Q	probably benign	Het
Fbxw7	A	C	3: 84,925,707	K19Q	possibly damaging	Het
Gldn	A	G	9: 54,338,662	K499R	possibly damaging	Het
Gm5514	T	G	19: 21,938,252		noncoding transcript	Het
Gria4	C	T	9: 4,513,295	M271I	probably benign	Het
Herc1	C	T	9: 66,445,640	T2136I	probably damaging	Het
Igsf10	A	G	3: 59,325,714	F1866S	probably benign	Het
Iqcg	G	T	16: 33,053,626		probably benign	Het
Itih2	A	T	2: 10,105,670	F537I	probably benign	Het
Itpr2	T	C	6: 146,382,700	D533G	probably damaging	Het
Kcnk15	A	G	2: 163,853,813	K22E	probably benign	Het
Lag3	A	T	6: 124,910,140	S155T	probably benign	Het
Lars	T	C	18: 42,212,602	E1003G	probably benign	Het
Layn	T	A	9: 51,059,544	N233I	probably damaging	Het
Lgi1	T	C	19: 38,306,246	Y465H	probably damaging	Het
Lrig1	C	T	6: 94,611,576	A531T	possibly damaging	Het
Lrrtm4	A	G	6: 80,019,655		probably benign	Het
Lsamp	T	A	16: 42,144,572	L264H	probably damaging	Het
Mthfd2	T	C	6: 83,313,475	E39G	probably damaging	Het
Mtx2	C	A	2: 74,847,262	A22E	probably damaging	Het
Nipal3	T	C	4: 135,463,846	T325A	probably damaging	Het
Nlrp14	A	T	7: 107,182,367	Y257F	probably benign	Het
Ola1	G	C	2: 73,156,860	R143G	probably damaging	Het
Olfr301	T	G	7: 86,412,633	I90M	probably damaging	Het
Otog	A	G	7: 46,288,368	T1834A	probably benign	Het
Oxr1	T	C	15: 41,848,701	I656T	probably damaging	Het
Panx1	GTTCTTCT	GTTCT	9: 15,006,171		probably benign	Het
Pcdh18	T	C	3: 49,754,791	S692G	probably benign	Het
Pcdhga1	A	G	18: 37,664,123	T727A	probably benign	Het
Pde9a	A	G	17: 31,448,427	E3G	possibly damaging	Het
Prl8a1	T	C	13: 27,579,733	E37G	probably damaging	Het
Robo2	A	C	16: 73,920,747	L1159W	possibly damaging	Het
Sfxn5	T	C	6: 85,299,276		probably benign	Het
Siah2	A	G	3: 58,676,250	V205A	probably damaging	Het
Spindoc	A	C	19: 7,374,301	L202R	probably damaging	Het
Spock3	T	A	8: 63,345,699	D251E	probably damaging	Het
Srp68	T	A	11: 116,273,956	K51*	probably null	Het
Ssbp2	T	C	13: 91,524,607	Y29H	probably damaging	Het
Sspo	T	C	6: 48,449,930	V231A	probably damaging	Het
Stk4	T	A	2: 164,088,908	M143K	probably benign	Het
Tecta	C	T	9: 42,392,106	V77M	possibly damaging	Het
Trpc3	A	T	3: 36,638,559	D761E	probably benign	Het
Tubb2a	T	C	13: 34,075,264	E181G	probably damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Ush2a	C	A	1: 188,944,760	N4756K	probably benign	Het
Vmn2r-ps159	G	T	4: 156,334,397		noncoding transcript	Het
Wapl	G	A	14: 34,736,764	V928I	probably damaging	Het
Zfand3	A	G	17: 30,192,656	K130R	probably benign	Het
Zfp934	A	T	13: 62,517,785	H347Q	probably damaging	Het

Other mutations in Rlf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00547:Rlf	APN	4	121170686	missense	possibly damaging	0.89
IGL00558:Rlf	APN	4	121150973	missense	probably damaging	1.00
IGL00990:Rlf	APN	4	121148339	missense	possibly damaging	0.87
IGL01625:Rlf	APN	4	121188260	missense	possibly damaging	0.68
IGL01921:Rlf	APN	4	121146746	missense	probably damaging	1.00
IGL01986:Rlf	APN	4	121148106	missense	probably damaging	1.00
IGL02232:Rlf	APN	4	121182614	missense	probably benign	0.21
IGL02586:Rlf	APN	4	121150064	missense	probably damaging	1.00
IGL03177:Rlf	APN	4	121148079	nonsense	probably null
IGL03233:Rlf	APN	4	121182600	splice site	probably benign
IGL03293:Rlf	APN	4	121148330	missense	probably benign	0.18
Brady	UTSW	4	121148553	nonsense	probably null
bunch	UTSW	4	121154975	missense	probably damaging	1.00
Rosary	UTSW	4	121148610	missense	probably damaging	0.99
transsubstantiation	UTSW	4	121148291	missense	probably benign	0.10
wafer	UTSW	4	121150532	missense	probably benign	0.00
Wine	UTSW	4	121148172	missense	probably damaging	1.00
PIT4651001:Rlf	UTSW	4	121150313	missense	probably damaging	0.98
R0019:Rlf	UTSW	4	121146572	missense	possibly damaging	0.46
R0019:Rlf	UTSW	4	121146572	missense	possibly damaging	0.46
R0039:Rlf	UTSW	4	121146842	missense	possibly damaging	0.90
R0041:Rlf	UTSW	4	121149929	missense	probably damaging	1.00
R0041:Rlf	UTSW	4	121149929	missense	probably damaging	1.00
R0590:Rlf	UTSW	4	121170833	splice site	probably benign
R1562:Rlf	UTSW	4	121150391	missense	possibly damaging	0.47
R1585:Rlf	UTSW	4	121148291	missense	probably benign	0.10
R1627:Rlf	UTSW	4	121150000	missense	probably benign	0.34
R1709:Rlf	UTSW	4	121149823	missense	probably benign	0.00
R1968:Rlf	UTSW	4	121148420	missense	probably damaging	1.00
R1982:Rlf	UTSW	4	121150112	missense	probably damaging	1.00
R3120:Rlf	UTSW	4	121149483	missense	probably benign	0.01
R3155:Rlf	UTSW	4	121149332	missense	probably damaging	1.00
R3162:Rlf	UTSW	4	121148847	missense	probably damaging	1.00
R3162:Rlf	UTSW	4	121148847	missense	probably damaging	1.00
R3429:Rlf	UTSW	4	121150532	missense	probably benign	0.00
R3430:Rlf	UTSW	4	121150532	missense	probably benign	0.00
R3700:Rlf	UTSW	4	121150863	missense	possibly damaging	0.77
R3909:Rlf	UTSW	4	121149032	missense	probably benign	0.00
R4033:Rlf	UTSW	4	121147343	missense	probably damaging	1.00
R4350:Rlf	UTSW	4	121149096	missense	probably benign	0.16
R4654:Rlf	UTSW	4	121150601	missense	probably benign	0.28
R4976:Rlf	UTSW	4	121147455	missense	probably damaging	0.98
R5060:Rlf	UTSW	4	121146866	missense	probably benign	0.00
R5105:Rlf	UTSW	4	121150367	missense	probably damaging	1.00
R5119:Rlf	UTSW	4	121147455	missense	probably damaging	0.98
R5150:Rlf	UTSW	4	121148172	missense	probably damaging	1.00
R5198:Rlf	UTSW	4	121148553	nonsense	probably null
R5214:Rlf	UTSW	4	121150700	missense	probably damaging	1.00
R6084:Rlf	UTSW	4	121149215	missense	possibly damaging	0.95
R6131:Rlf	UTSW	4	121154975	missense	probably damaging	1.00
R6188:Rlf	UTSW	4	121170766	missense	probably damaging	1.00
R6313:Rlf	UTSW	4	121148610	missense	probably damaging	0.99
R6332:Rlf	UTSW	4	121148822	missense	possibly damaging	0.75
R6341:Rlf	UTSW	4	121149360	nonsense	probably null
R6413:Rlf	UTSW	4	121147325	missense	probably damaging	1.00
R6683:Rlf	UTSW	4	121147926	missense	probably damaging	1.00
R7066:Rlf	UTSW	4	121148787	missense	probably benign
R7413:Rlf	UTSW	4	121150100	missense	probably damaging	1.00
R7640:Rlf	UTSW	4	121146801	missense	possibly damaging	0.96
R7641:Rlf	UTSW	4	121159196	missense	probably damaging	1.00
R7855:Rlf	UTSW	4	121182691	missense	possibly damaging	0.93
R8127:Rlf	UTSW	4	121147896	missense	possibly damaging	0.89
R8146:Rlf	UTSW	4	121147232	missense	probably benign	0.16
R8182:Rlf	UTSW	4	121150905	missense	possibly damaging	0.94
R8350:Rlf	UTSW	4	121170757	missense	probably damaging	0.98
R8375:Rlf	UTSW	4	121148335	missense	probably damaging	0.96
R8754:Rlf	UTSW	4	121146813	missense	possibly damaging	0.90
R8837:Rlf	UTSW	4	121188235	missense	probably benign	0.06
R8901:Rlf	UTSW	4	121146813	missense	possibly damaging	0.90
R9054:Rlf	UTSW	4	121150587	missense	possibly damaging	0.47
R9090:Rlf	UTSW	4	121147554	missense	probably benign
R9144:Rlf	UTSW	4	121146703	missense	probably benign	0.16
R9265:Rlf	UTSW	4	121150290	missense	possibly damaging	0.63
R9271:Rlf	UTSW	4	121147554	missense	probably benign
R9549:Rlf	UTSW	4	121148123	missense	probably damaging	1.00
R9550:Rlf	UTSW	4	121146423	missense	probably damaging	1.00
R9570:Rlf	UTSW	4	121149890	missense	possibly damaging	0.90
R9627:Rlf	UTSW	4	121149805	nonsense	probably null
R9652:Rlf	UTSW	4	121150668	missense	probably damaging	1.00
Z1176:Rlf	UTSW	4	121150428	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCGAATCAGGCCTTTTAGATTG -3'
(R):5'- ACATCAAATTGGCAGTGACAGG -3'

Sequencing Primer
(F):5'- CAGGCCTTTTAGATTGGTAAATGAAG -3'
(R):5'- GGGCAACTCACAGACTGTTAGAC -3'

Posted On

2015-11-11