Incidental Mutation 'R3732:Mthfd2'
ID 356380
Institutional Source Beutler Lab
Gene Symbol Mthfd2
Ensembl Gene ENSMUSG00000005667
Gene Name methylenetetrahydrofolate dehydrogenase (NAD+ dependent), methenyltetrahydrofolate cyclohydrolase
Synonyms NMDMC
MMRRC Submission 040720-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3732 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 83282673-83302890 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 83290457 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 39 (E39G)
Ref Sequence ENSEMBL: ENSMUSP00000145222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005810] [ENSMUST00000203847] [ENSMUST00000204472]
AlphaFold P18155
Predicted Effect probably damaging
Transcript: ENSMUST00000005810
AA Change: E58G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000005810
Gene: ENSMUSG00000005667
AA Change: E58G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:THF_DHG_CYH 39 155 8.1e-45 PFAM
Pfam:THF_DHG_CYH_C 158 332 7.7e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139802
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141044
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203375
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203437
Predicted Effect probably damaging
Transcript: ENSMUST00000203847
AA Change: E58G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000145266
Gene: ENSMUSG00000005667
AA Change: E58G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:THF_DHG_CYH 39 108 2e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204472
AA Change: E39G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000145222
Gene: ENSMUSG00000005667
AA Change: E39G

DomainStartEndE-ValueType
Pfam:THF_DHG_CYH 20 97 2.2e-20 PFAM
Meta Mutation Damage Score 0.2316 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 93% (56/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear-encoded mitochondrial bifunctional enzyme with methylenetetrahydrofolate dehydrogenase and methenyltetrahydrofolate cyclohydrolase activities. The enzyme functions as a homodimer and is unique in its absolute requirement for magnesium and inorganic phosphate. Formation of the enzyme-magnesium complex allows binding of NAD. Alternative splicing results in two different transcripts, one protein-coding and the other not protein-coding. This gene has a pseudogene on chromosome 7. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos before E15.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,684,980 (GRCm39) C172* probably null Het
Aacs C T 5: 125,583,326 (GRCm39) T294M probably damaging Het
Ablim1 A T 19: 57,037,892 (GRCm39) probably null Het
Adgrf4 C T 17: 42,983,472 (GRCm39) G70E probably damaging Het
Adgrl3 C A 5: 81,942,793 (GRCm39) H1474Q probably benign Het
Adgrv1 T C 13: 81,705,075 (GRCm39) I1578M probably damaging Het
Afg3l1 G A 8: 124,227,972 (GRCm39) G547D probably damaging Het
Ambra1 G A 2: 91,640,476 (GRCm39) R635H probably damaging Het
Araf TACACACACACACACACA TACACACACACACACA X: 20,716,465 (GRCm39) probably benign Het
Arhgef10l AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 4: 140,308,930 (GRCm39) probably benign Het
Bcl7b A G 5: 135,209,767 (GRCm39) T141A probably benign Het
Calm5 T A 13: 3,904,337 (GRCm39) N10K probably damaging Het
Camsap1 T C 2: 25,828,356 (GRCm39) R1123G probably damaging Het
Cfap97d1 C T 11: 101,879,278 (GRCm39) Q17* probably null Het
Chrna3 T C 9: 54,923,178 (GRCm39) K210R probably benign Het
Ciz1 A G 2: 32,257,495 (GRCm39) N180S possibly damaging Het
Cntnap3 G A 13: 64,888,813 (GRCm39) A1162V possibly damaging Het
Cox5b C T 1: 36,732,341 (GRCm39) P114L probably damaging Het
Cpsf2 T C 12: 101,953,567 (GRCm39) I199T probably damaging Het
Cyp2a4 A G 7: 26,012,252 (GRCm39) D345G probably damaging Het
Cyp2s1 C T 7: 25,503,379 (GRCm39) R424Q probably null Het
D1Pas1 C A 1: 186,700,294 (GRCm39) S74R probably benign Het
Ddx4 T A 13: 112,748,516 (GRCm39) I487F possibly damaging Het
Dnah5 A T 15: 28,409,268 (GRCm39) E3562V possibly damaging Het
Dpf3 T C 12: 83,316,281 (GRCm39) D330G possibly damaging Het
Edem1 T C 6: 108,818,582 (GRCm39) F197L probably damaging Het
Eeig1 G A 2: 32,456,304 (GRCm39) S322N probably benign Het
Ergic2 T C 6: 148,104,020 (GRCm39) D79G probably damaging Het
Espl1 A G 15: 102,221,424 (GRCm39) I944V probably damaging Het
Fam111a T C 19: 12,564,914 (GRCm39) L221P possibly damaging Het
Fat1 T C 8: 45,406,306 (GRCm39) V1019A possibly damaging Het
Fbxl21 T A 13: 56,674,830 (GRCm39) H60Q probably benign Het
Fbxw7 A C 3: 84,833,014 (GRCm39) K19Q possibly damaging Het
Gldn A G 9: 54,245,946 (GRCm39) K499R possibly damaging Het
Gria4 C T 9: 4,513,295 (GRCm39) M271I probably benign Het
Herc1 C T 9: 66,352,922 (GRCm39) T2136I probably damaging Het
Igsf10 A G 3: 59,233,135 (GRCm39) F1866S probably benign Het
Iqcg G T 16: 32,873,996 (GRCm39) probably benign Het
Itih2 A T 2: 10,110,481 (GRCm39) F537I probably benign Het
Itpr2 T C 6: 146,284,198 (GRCm39) D533G probably damaging Het
Kcnk15 A G 2: 163,695,733 (GRCm39) K22E probably benign Het
Lag3 A T 6: 124,887,103 (GRCm39) S155T probably benign Het
Lars1 T C 18: 42,345,667 (GRCm39) E1003G probably benign Het
Layn T A 9: 50,970,844 (GRCm39) N233I probably damaging Het
Ldhb-ps T G 19: 21,915,616 (GRCm39) noncoding transcript Het
Lgi1 T C 19: 38,294,694 (GRCm39) Y465H probably damaging Het
Lrig1 C T 6: 94,588,557 (GRCm39) A531T possibly damaging Het
Lrrtm4 A G 6: 79,996,638 (GRCm39) probably benign Het
Lsamp T A 16: 41,964,935 (GRCm39) L264H probably damaging Het
Mtx2 C A 2: 74,677,606 (GRCm39) A22E probably damaging Het
Nipal3 T C 4: 135,191,157 (GRCm39) T325A probably damaging Het
Nlrp14 A T 7: 106,781,574 (GRCm39) Y257F probably benign Het
Ola1 G C 2: 72,987,204 (GRCm39) R143G probably damaging Het
Or14c44 T G 7: 86,061,841 (GRCm39) I90M probably damaging Het
Otog A G 7: 45,937,792 (GRCm39) T1834A probably benign Het
Oxr1 T C 15: 41,712,097 (GRCm39) I656T probably damaging Het
Panx1 GTTCTTCT GTTCT 9: 14,917,467 (GRCm39) probably benign Het
Pcdh18 T C 3: 49,709,240 (GRCm39) S692G probably benign Het
Pcdhga1 A G 18: 37,797,176 (GRCm39) T727A probably benign Het
Pde9a A G 17: 31,667,401 (GRCm39) E3G possibly damaging Het
Prl8a1 T C 13: 27,763,716 (GRCm39) E37G probably damaging Het
Rlf C T 4: 121,005,521 (GRCm39) G1153D probably benign Het
Robo2 A C 16: 73,717,635 (GRCm39) L1159W possibly damaging Het
Sfxn5 T C 6: 85,276,258 (GRCm39) probably benign Het
Siah2 A G 3: 58,583,671 (GRCm39) V205A probably damaging Het
Spindoc A C 19: 7,351,666 (GRCm39) L202R probably damaging Het
Spock3 T A 8: 63,798,733 (GRCm39) D251E probably damaging Het
Srp68 T A 11: 116,164,782 (GRCm39) K51* probably null Het
Ssbp2 T C 13: 91,672,726 (GRCm39) Y29H probably damaging Het
Sspo T C 6: 48,426,864 (GRCm39) V231A probably damaging Het
Stk4 T A 2: 163,930,828 (GRCm39) M143K probably benign Het
Tecta C T 9: 42,303,402 (GRCm39) V77M possibly damaging Het
Trpc3 A T 3: 36,692,708 (GRCm39) D761E probably benign Het
Tubb2a T C 13: 34,259,247 (GRCm39) E181G probably damaging Het
Ugcg C T 4: 59,207,798 (GRCm39) P46S probably benign Het
Ush2a C A 1: 188,676,957 (GRCm39) N4756K probably benign Het
Vmn2r129 G T 4: 156,686,692 (GRCm39) noncoding transcript Het
Wapl G A 14: 34,458,721 (GRCm39) V928I probably damaging Het
Zfand3 A G 17: 30,411,630 (GRCm39) K130R probably benign Het
Zfp934 A T 13: 62,665,599 (GRCm39) H347Q probably damaging Het
Other mutations in Mthfd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01825:Mthfd2 APN 6 83,287,493 (GRCm39) missense probably benign 0.12
IGL01844:Mthfd2 APN 6 83,288,792 (GRCm39) critical splice donor site probably null
IGL02936:Mthfd2 APN 6 83,288,342 (GRCm39) missense probably damaging 1.00
R0130:Mthfd2 UTSW 6 83,285,990 (GRCm39) missense probably damaging 0.99
R0862:Mthfd2 UTSW 6 83,290,376 (GRCm39) missense probably damaging 0.99
R1902:Mthfd2 UTSW 6 83,283,713 (GRCm39) missense probably damaging 1.00
R3431:Mthfd2 UTSW 6 83,288,330 (GRCm39) missense probably benign 0.30
R4473:Mthfd2 UTSW 6 83,287,517 (GRCm39) unclassified probably benign
R5301:Mthfd2 UTSW 6 83,287,465 (GRCm39) missense probably damaging 1.00
R5730:Mthfd2 UTSW 6 83,294,441 (GRCm39) missense probably benign 0.35
R7126:Mthfd2 UTSW 6 83,290,472 (GRCm39) missense probably benign 0.02
R7594:Mthfd2 UTSW 6 83,283,665 (GRCm39) missense probably benign 0.00
R7602:Mthfd2 UTSW 6 83,288,830 (GRCm39) missense probably benign 0.01
R7916:Mthfd2 UTSW 6 83,286,455 (GRCm39) missense possibly damaging 0.79
R9709:Mthfd2 UTSW 6 83,283,665 (GRCm39) missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- GTCACTGAAAGCCCTCCCTC -3'
(R):5'- TGGATCTCATATTTAAACGTAAGCC -3'

Sequencing Primer
(F):5'- GATGACCTCAAACATGCTATGTGGC -3'
(R):5'- GCCGTTGTCATTTCTGGA -3'
Posted On 2015-11-11