Incidental Mutation 'R3732:Ergic2'
ID 356381
Institutional Source Beutler Lab
Gene Symbol Ergic2
Ensembl Gene ENSMUSG00000030304
Gene Name ERGIC and golgi 2
Synonyms 1200009B18Rik, 4930572C01Rik
MMRRC Submission 040720-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.458) question?
Stock # R3732 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 148080816-148113886 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 148104020 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 79 (D79G)
Ref Sequence ENSEMBL: ENSMUSP00000116551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032446] [ENSMUST00000126698] [ENSMUST00000130242] [ENSMUST00000136008]
AlphaFold Q9CR89
Predicted Effect probably benign
Transcript: ENSMUST00000032446
Predicted Effect probably damaging
Transcript: ENSMUST00000032447
AA Change: D79G

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000032447
Gene: ENSMUSG00000030304
AA Change: D79G

DomainStartEndE-ValueType
Pfam:ERGIC_N 12 105 1.5e-22 PFAM
Pfam:COPIIcoated_ERV 158 300 2.7e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125469
Predicted Effect probably damaging
Transcript: ENSMUST00000126698
AA Change: D79G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116551
Gene: ENSMUSG00000030304
AA Change: D79G

DomainStartEndE-ValueType
Pfam:ERGIC_N 12 100 1.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130242
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132413
Predicted Effect probably damaging
Transcript: ENSMUST00000136008
AA Change: D79G

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000120456
Gene: ENSMUSG00000030304
AA Change: D79G

DomainStartEndE-ValueType
Pfam:ERGIC_N 13 101 1.6e-26 PFAM
Pfam:COPIIcoated_ERV 157 333 4.8e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148437
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150980
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203993
Meta Mutation Damage Score 0.8357 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 93% (56/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ERGIC2, or PTX1, is a ubiquitously expressed nuclear protein that is downregulated in prostate carcinoma (Kwok et al., 2001 [PubMed 11445006]).[supplied by OMIM, Aug 2008]
PHENOTYPE: Mice homozygous for an ENU-induced point mutation affecting the donor splice site of intron 5 exhibit swelling of the hind feet and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,684,980 (GRCm39) C172* probably null Het
Aacs C T 5: 125,583,326 (GRCm39) T294M probably damaging Het
Ablim1 A T 19: 57,037,892 (GRCm39) probably null Het
Adgrf4 C T 17: 42,983,472 (GRCm39) G70E probably damaging Het
Adgrl3 C A 5: 81,942,793 (GRCm39) H1474Q probably benign Het
Adgrv1 T C 13: 81,705,075 (GRCm39) I1578M probably damaging Het
Afg3l1 G A 8: 124,227,972 (GRCm39) G547D probably damaging Het
Ambra1 G A 2: 91,640,476 (GRCm39) R635H probably damaging Het
Araf TACACACACACACACACA TACACACACACACACA X: 20,716,465 (GRCm39) probably benign Het
Arhgef10l AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 4: 140,308,930 (GRCm39) probably benign Het
Bcl7b A G 5: 135,209,767 (GRCm39) T141A probably benign Het
Calm5 T A 13: 3,904,337 (GRCm39) N10K probably damaging Het
Camsap1 T C 2: 25,828,356 (GRCm39) R1123G probably damaging Het
Cfap97d1 C T 11: 101,879,278 (GRCm39) Q17* probably null Het
Chrna3 T C 9: 54,923,178 (GRCm39) K210R probably benign Het
Ciz1 A G 2: 32,257,495 (GRCm39) N180S possibly damaging Het
Cntnap3 G A 13: 64,888,813 (GRCm39) A1162V possibly damaging Het
Cox5b C T 1: 36,732,341 (GRCm39) P114L probably damaging Het
Cpsf2 T C 12: 101,953,567 (GRCm39) I199T probably damaging Het
Cyp2a4 A G 7: 26,012,252 (GRCm39) D345G probably damaging Het
Cyp2s1 C T 7: 25,503,379 (GRCm39) R424Q probably null Het
D1Pas1 C A 1: 186,700,294 (GRCm39) S74R probably benign Het
Ddx4 T A 13: 112,748,516 (GRCm39) I487F possibly damaging Het
Dnah5 A T 15: 28,409,268 (GRCm39) E3562V possibly damaging Het
Dpf3 T C 12: 83,316,281 (GRCm39) D330G possibly damaging Het
Edem1 T C 6: 108,818,582 (GRCm39) F197L probably damaging Het
Eeig1 G A 2: 32,456,304 (GRCm39) S322N probably benign Het
Espl1 A G 15: 102,221,424 (GRCm39) I944V probably damaging Het
Fam111a T C 19: 12,564,914 (GRCm39) L221P possibly damaging Het
Fat1 T C 8: 45,406,306 (GRCm39) V1019A possibly damaging Het
Fbxl21 T A 13: 56,674,830 (GRCm39) H60Q probably benign Het
Fbxw7 A C 3: 84,833,014 (GRCm39) K19Q possibly damaging Het
Gldn A G 9: 54,245,946 (GRCm39) K499R possibly damaging Het
Gria4 C T 9: 4,513,295 (GRCm39) M271I probably benign Het
Herc1 C T 9: 66,352,922 (GRCm39) T2136I probably damaging Het
Igsf10 A G 3: 59,233,135 (GRCm39) F1866S probably benign Het
Iqcg G T 16: 32,873,996 (GRCm39) probably benign Het
Itih2 A T 2: 10,110,481 (GRCm39) F537I probably benign Het
Itpr2 T C 6: 146,284,198 (GRCm39) D533G probably damaging Het
Kcnk15 A G 2: 163,695,733 (GRCm39) K22E probably benign Het
Lag3 A T 6: 124,887,103 (GRCm39) S155T probably benign Het
Lars1 T C 18: 42,345,667 (GRCm39) E1003G probably benign Het
Layn T A 9: 50,970,844 (GRCm39) N233I probably damaging Het
Ldhb-ps T G 19: 21,915,616 (GRCm39) noncoding transcript Het
Lgi1 T C 19: 38,294,694 (GRCm39) Y465H probably damaging Het
Lrig1 C T 6: 94,588,557 (GRCm39) A531T possibly damaging Het
Lrrtm4 A G 6: 79,996,638 (GRCm39) probably benign Het
Lsamp T A 16: 41,964,935 (GRCm39) L264H probably damaging Het
Mthfd2 T C 6: 83,290,457 (GRCm39) E39G probably damaging Het
Mtx2 C A 2: 74,677,606 (GRCm39) A22E probably damaging Het
Nipal3 T C 4: 135,191,157 (GRCm39) T325A probably damaging Het
Nlrp14 A T 7: 106,781,574 (GRCm39) Y257F probably benign Het
Ola1 G C 2: 72,987,204 (GRCm39) R143G probably damaging Het
Or14c44 T G 7: 86,061,841 (GRCm39) I90M probably damaging Het
Otog A G 7: 45,937,792 (GRCm39) T1834A probably benign Het
Oxr1 T C 15: 41,712,097 (GRCm39) I656T probably damaging Het
Panx1 GTTCTTCT GTTCT 9: 14,917,467 (GRCm39) probably benign Het
Pcdh18 T C 3: 49,709,240 (GRCm39) S692G probably benign Het
Pcdhga1 A G 18: 37,797,176 (GRCm39) T727A probably benign Het
Pde9a A G 17: 31,667,401 (GRCm39) E3G possibly damaging Het
Prl8a1 T C 13: 27,763,716 (GRCm39) E37G probably damaging Het
Rlf C T 4: 121,005,521 (GRCm39) G1153D probably benign Het
Robo2 A C 16: 73,717,635 (GRCm39) L1159W possibly damaging Het
Sfxn5 T C 6: 85,276,258 (GRCm39) probably benign Het
Siah2 A G 3: 58,583,671 (GRCm39) V205A probably damaging Het
Spindoc A C 19: 7,351,666 (GRCm39) L202R probably damaging Het
Spock3 T A 8: 63,798,733 (GRCm39) D251E probably damaging Het
Srp68 T A 11: 116,164,782 (GRCm39) K51* probably null Het
Ssbp2 T C 13: 91,672,726 (GRCm39) Y29H probably damaging Het
Sspo T C 6: 48,426,864 (GRCm39) V231A probably damaging Het
Stk4 T A 2: 163,930,828 (GRCm39) M143K probably benign Het
Tecta C T 9: 42,303,402 (GRCm39) V77M possibly damaging Het
Trpc3 A T 3: 36,692,708 (GRCm39) D761E probably benign Het
Tubb2a T C 13: 34,259,247 (GRCm39) E181G probably damaging Het
Ugcg C T 4: 59,207,798 (GRCm39) P46S probably benign Het
Ush2a C A 1: 188,676,957 (GRCm39) N4756K probably benign Het
Vmn2r129 G T 4: 156,686,692 (GRCm39) noncoding transcript Het
Wapl G A 14: 34,458,721 (GRCm39) V928I probably damaging Het
Zfand3 A G 17: 30,411,630 (GRCm39) K130R probably benign Het
Zfp934 A T 13: 62,665,599 (GRCm39) H347Q probably damaging Het
Other mutations in Ergic2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01083:Ergic2 APN 6 148,096,769 (GRCm39) missense probably benign
IGL02191:Ergic2 APN 6 148,106,319 (GRCm39) missense probably null 0.12
IGL02719:Ergic2 APN 6 148,106,317 (GRCm39) missense possibly damaging 0.82
IGL02958:Ergic2 APN 6 148,083,441 (GRCm39) makesense probably null
R0389:Ergic2 UTSW 6 148,084,700 (GRCm39) missense probably benign 0.40
R0416:Ergic2 UTSW 6 148,084,642 (GRCm39) missense probably damaging 1.00
R0727:Ergic2 UTSW 6 148,100,898 (GRCm39) unclassified probably benign
R1835:Ergic2 UTSW 6 148,091,079 (GRCm39) missense possibly damaging 0.61
R1891:Ergic2 UTSW 6 148,084,577 (GRCm39) missense probably damaging 0.99
R1959:Ergic2 UTSW 6 148,100,852 (GRCm39) critical splice donor site probably null
R2504:Ergic2 UTSW 6 148,106,272 (GRCm39) critical splice donor site probably null
R3414:Ergic2 UTSW 6 148,108,179 (GRCm39) splice site probably benign
R3732:Ergic2 UTSW 6 148,104,020 (GRCm39) missense probably damaging 1.00
R3733:Ergic2 UTSW 6 148,104,020 (GRCm39) missense probably damaging 1.00
R3734:Ergic2 UTSW 6 148,104,020 (GRCm39) missense probably damaging 1.00
R5002:Ergic2 UTSW 6 148,085,656 (GRCm39) missense probably benign 0.00
R5083:Ergic2 UTSW 6 148,097,512 (GRCm39) missense probably benign 0.00
R5088:Ergic2 UTSW 6 148,084,621 (GRCm39) missense probably damaging 1.00
R5850:Ergic2 UTSW 6 148,084,605 (GRCm39) missense possibly damaging 0.93
R6541:Ergic2 UTSW 6 148,084,648 (GRCm39) missense probably damaging 1.00
R6652:Ergic2 UTSW 6 148,091,079 (GRCm39) missense probably damaging 1.00
R7073:Ergic2 UTSW 6 148,096,707 (GRCm39) missense probably damaging 1.00
R7167:Ergic2 UTSW 6 148,108,133 (GRCm39) missense probably damaging 1.00
R7275:Ergic2 UTSW 6 148,096,757 (GRCm39) missense probably damaging 1.00
R7299:Ergic2 UTSW 6 148,089,610 (GRCm39) missense probably damaging 1.00
R8732:Ergic2 UTSW 6 148,102,975 (GRCm39) missense probably damaging 1.00
R8864:Ergic2 UTSW 6 148,083,393 (GRCm39) missense probably benign 0.00
R8948:Ergic2 UTSW 6 148,104,005 (GRCm39) missense probably damaging 0.99
R9437:Ergic2 UTSW 6 148,097,562 (GRCm39) missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- AGCCTGACTCTACACTGGAGAC -3'
(R):5'- TTGCAGTTAACAAAGGTGACTG -3'

Sequencing Primer
(F):5'- TGGAGACAGACTACCTAAAGCAC -3'
(R):5'- TGTCAGGCTGTTCACACAAAAG -3'
Posted On 2015-11-11