Incidental Mutation 'R3732:Prl8a1'
ID356392
Institutional Source Beutler Lab
Gene Symbol Prl8a1
Ensembl Gene ENSMUSG00000019756
Gene Nameprolactin family 8, subfamily a, member 1
Synonyms3830403L08Rik, 1600017L04Rik, Plpcd, PLP-Cd, Prlpc4
MMRRC Submission 040720-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R3732 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location27573922-27582171 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27579733 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 37 (E37G)
Ref Sequence ENSEMBL: ENSMUSP00000093616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006664] [ENSMUST00000095926]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006664
AA Change: E37G

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000006664
Gene: ENSMUSG00000019756
AA Change: E37G

DomainStartEndE-ValueType
Pfam:Hormone_1 16 240 7.2e-60 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000095926
AA Change: E37G

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000093616
Gene: ENSMUSG00000019756
AA Change: E37G

DomainStartEndE-ValueType
Pfam:Hormone_1 16 193 1e-39 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 93% (56/60)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik C T 11: 101,988,452 Q17* probably null Het
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Aacs C T 5: 125,506,262 T294M probably damaging Het
Ablim1 A T 19: 57,049,460 probably null Het
Adgrf4 C T 17: 42,672,581 G70E probably damaging Het
Adgrl3 C A 5: 81,794,946 H1474Q probably benign Het
Adgrv1 T C 13: 81,556,956 I1578M probably damaging Het
Afg3l1 G A 8: 123,501,233 G547D probably damaging Het
Ambra1 G A 2: 91,810,131 R635H probably damaging Het
Araf TACACACACACACACACA TACACACACACACACA X: 20,850,226 probably benign Het
Arhgef10l AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 4: 140,581,619 probably benign Het
Bcl7b A G 5: 135,180,913 T141A probably benign Het
Calm5 T A 13: 3,854,337 N10K probably damaging Het
Camsap1 T C 2: 25,938,344 R1123G probably damaging Het
Chrna3 T C 9: 55,015,894 K210R probably benign Het
Ciz1 A G 2: 32,367,483 N180S possibly damaging Het
Cntnap3 G A 13: 64,740,999 A1162V possibly damaging Het
Cox5b C T 1: 36,693,260 P114L probably damaging Het
Cpsf2 T C 12: 101,987,308 I199T probably damaging Het
Cyp2a4 A G 7: 26,312,827 D345G probably damaging Het
Cyp2s1 C T 7: 25,803,954 R424Q probably null Het
D1Pas1 C A 1: 186,968,097 S74R probably benign Het
Ddx4 T A 13: 112,611,982 I487F possibly damaging Het
Dnah5 A T 15: 28,409,122 E3562V possibly damaging Het
Dpf3 T C 12: 83,269,507 D330G possibly damaging Het
Edem1 T C 6: 108,841,621 F197L probably damaging Het
Ergic2 T C 6: 148,202,522 D79G probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fam102a G A 2: 32,566,292 S322N probably benign Het
Fam111a T C 19: 12,587,550 L221P possibly damaging Het
Fat1 T C 8: 44,953,269 V1019A possibly damaging Het
Fbxl21 T A 13: 56,527,017 H60Q probably benign Het
Fbxw7 A C 3: 84,925,707 K19Q possibly damaging Het
Gldn A G 9: 54,338,662 K499R possibly damaging Het
Gm5514 T G 19: 21,938,252 noncoding transcript Het
Gria4 C T 9: 4,513,295 M271I probably benign Het
Herc1 C T 9: 66,445,640 T2136I probably damaging Het
Igsf10 A G 3: 59,325,714 F1866S probably benign Het
Iqcg G T 16: 33,053,626 probably benign Het
Itih2 A T 2: 10,105,670 F537I probably benign Het
Itpr2 T C 6: 146,382,700 D533G probably damaging Het
Kcnk15 A G 2: 163,853,813 K22E probably benign Het
Lag3 A T 6: 124,910,140 S155T probably benign Het
Lars T C 18: 42,212,602 E1003G probably benign Het
Layn T A 9: 51,059,544 N233I probably damaging Het
Lgi1 T C 19: 38,306,246 Y465H probably damaging Het
Lrig1 C T 6: 94,611,576 A531T possibly damaging Het
Lrrtm4 A G 6: 80,019,655 probably benign Het
Lsamp T A 16: 42,144,572 L264H probably damaging Het
Mthfd2 T C 6: 83,313,475 E39G probably damaging Het
Mtx2 C A 2: 74,847,262 A22E probably damaging Het
Nipal3 T C 4: 135,463,846 T325A probably damaging Het
Nlrp14 A T 7: 107,182,367 Y257F probably benign Het
Ola1 G C 2: 73,156,860 R143G probably damaging Het
Olfr301 T G 7: 86,412,633 I90M probably damaging Het
Otog A G 7: 46,288,368 T1834A probably benign Het
Oxr1 T C 15: 41,848,701 I656T probably damaging Het
Panx1 GTTCTTCT GTTCT 9: 15,006,171 probably benign Het
Pcdh18 T C 3: 49,754,791 S692G probably benign Het
Pcdhga1 A G 18: 37,664,123 T727A probably benign Het
Pde9a A G 17: 31,448,427 E3G possibly damaging Het
Rlf C T 4: 121,148,324 G1153D probably benign Het
Robo2 A C 16: 73,920,747 L1159W possibly damaging Het
Sfxn5 T C 6: 85,299,276 probably benign Het
Siah2 A G 3: 58,676,250 V205A probably damaging Het
Spindoc A C 19: 7,374,301 L202R probably damaging Het
Spock3 T A 8: 63,345,699 D251E probably damaging Het
Srp68 T A 11: 116,273,956 K51* probably null Het
Ssbp2 T C 13: 91,524,607 Y29H probably damaging Het
Sspo T C 6: 48,449,930 V231A probably damaging Het
Stk4 T A 2: 164,088,908 M143K probably benign Het
Tecta C T 9: 42,392,106 V77M possibly damaging Het
Trpc3 A T 3: 36,638,559 D761E probably benign Het
Tubb2a T C 13: 34,075,264 E181G probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ush2a C A 1: 188,944,760 N4756K probably benign Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Wapl G A 14: 34,736,764 V928I probably damaging Het
Zfand3 A G 17: 30,192,656 K130R probably benign Het
Zfp934 A T 13: 62,517,785 H347Q probably damaging Het
Other mutations in Prl8a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02259:Prl8a1 APN 13 27582106 missense probably benign 0.23
IGL02369:Prl8a1 APN 13 27576941 missense possibly damaging 0.58
IGL03257:Prl8a1 APN 13 27575673 missense probably damaging 1.00
IGL02837:Prl8a1 UTSW 13 27575634 missense probably damaging 1.00
R0838:Prl8a1 UTSW 13 27574025 missense probably damaging 1.00
R1480:Prl8a1 UTSW 13 27574072 missense possibly damaging 0.84
R1973:Prl8a1 UTSW 13 27576934 missense probably benign 0.07
R2352:Prl8a1 UTSW 13 27575589 missense probably damaging 1.00
R2396:Prl8a1 UTSW 13 27574024 missense probably benign 0.00
R3874:Prl8a1 UTSW 13 27575458 missense possibly damaging 0.53
R4895:Prl8a1 UTSW 13 27575530 missense probably benign 0.20
R5135:Prl8a1 UTSW 13 27579819 splice site probably null
R5139:Prl8a1 UTSW 13 27574066 missense probably damaging 0.98
R5908:Prl8a1 UTSW 13 27574057 missense probably benign 0.00
R6232:Prl8a1 UTSW 13 27575574 missense possibly damaging 0.86
R6262:Prl8a1 UTSW 13 27574143 missense possibly damaging 0.95
R7203:Prl8a1 UTSW 13 27574189 missense probably damaging 0.99
R7243:Prl8a1 UTSW 13 27582103 missense probably damaging 1.00
R7372:Prl8a1 UTSW 13 27574106 missense probably damaging 0.97
R7485:Prl8a1 UTSW 13 27574085 missense probably damaging 1.00
R8115:Prl8a1 UTSW 13 27574045 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAGTAGTTGAAGCATCCTTTACC -3'
(R):5'- TGCCATTCCAGATATCCCATAC -3'

Sequencing Primer
(F):5'- GTTGAAGCATCCTTTACCTATGAAG -3'
(R):5'- AGATATCCCATACAACATCATACAGG -3'
Posted On2015-11-11