Mutagenetix > Incidental Mutation

Incidental Mutation 'R3732:Cntnap3'

356395

Institutional Source

Beutler Lab

Gene Symbol

Cntnap3

Ensembl Gene

ENSMUSG00000033063

Gene Name

contactin associated protein-like 3

Synonyms

MMRRC Submission

040720-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.055) question?

Stock #

R3732 (G1)

Quality Score

210

Status

Validated

Chromosome

Chromosomal Location

64736182-64903955 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 64740999 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 1162 (A1162V)

Ref Sequence

ENSEMBL: ENSMUSP00000089140 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091554]

AlphaFold

E9PY62

Predicted Effect

possibly damaging
Transcript: ENSMUST00000091554
AA Change: A1162V

PolyPhen 2 Score 0.728 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000089140
Gene: ENSMUSG00000033063
AA Change: A1162V

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
FA58C	33	180	4.88e-17	SMART
LamG	207	345	1.47e-11	SMART
LamG	394	525	1.43e-23	SMART
EGF	553	587	1.33e-1	SMART
FBG	590	775	6.76e-1	SMART
LamG	815	942	1.89e-32	SMART
EGF_like	963	999	6.28e1	SMART
LamG	1040	1178	9.46e-15	SMART
transmembrane domain	1245	1267	N/A	INTRINSIC

Meta Mutation Damage Score

0.2977

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.6%

Validation Efficiency

93% (56/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NCP family of cell-recognition molecules. This family represents a distinct subgroup of the neurexins. NCP proteins mediate neuron-glial interactions in vertebrates and glial-glial contact in invertebrates. The protein encoded by this gene may play a role in cell recognition within the nervous system. Alternatively spliced transcript variants encoding different isoforms have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006E09Rik	C	T	11: 101,988,452	Q17*	probably null	Het
1700012B07Rik	G	T	11: 109,794,154	C172*	probably null	Het
Aacs	C	T	5: 125,506,262	T294M	probably damaging	Het
Ablim1	A	T	19: 57,049,460		probably null	Het
Adgrf4	C	T	17: 42,672,581	G70E	probably damaging	Het
Adgrl3	C	A	5: 81,794,946	H1474Q	probably benign	Het
Adgrv1	T	C	13: 81,556,956	I1578M	probably damaging	Het
Afg3l1	G	A	8: 123,501,233	G547D	probably damaging	Het
Ambra1	G	A	2: 91,810,131	R635H	probably damaging	Het
Araf	TACACACACACACACACA	TACACACACACACACA	X: 20,850,226		probably benign	Het
Arhgef10l	AGAGGAGGAGGAGGAGGA	AGAGGAGGAGGAGGA	4: 140,581,619		probably benign	Het
Bcl7b	A	G	5: 135,180,913	T141A	probably benign	Het
Calm5	T	A	13: 3,854,337	N10K	probably damaging	Het
Camsap1	T	C	2: 25,938,344	R1123G	probably damaging	Het
Chrna3	T	C	9: 55,015,894	K210R	probably benign	Het
Ciz1	A	G	2: 32,367,483	N180S	possibly damaging	Het
Cox5b	C	T	1: 36,693,260	P114L	probably damaging	Het
Cpsf2	T	C	12: 101,987,308	I199T	probably damaging	Het
Cyp2a4	A	G	7: 26,312,827	D345G	probably damaging	Het
Cyp2s1	C	T	7: 25,803,954	R424Q	probably null	Het
D1Pas1	C	A	1: 186,968,097	S74R	probably benign	Het
Ddx4	T	A	13: 112,611,982	I487F	possibly damaging	Het
Dnah5	A	T	15: 28,409,122	E3562V	possibly damaging	Het
Dpf3	T	C	12: 83,269,507	D330G	possibly damaging	Het
Edem1	T	C	6: 108,841,621	F197L	probably damaging	Het
Ergic2	T	C	6: 148,202,522	D79G	probably damaging	Het
Espl1	A	G	15: 102,312,989	I944V	probably damaging	Het
Fam102a	G	A	2: 32,566,292	S322N	probably benign	Het
Fam111a	T	C	19: 12,587,550	L221P	possibly damaging	Het
Fat1	T	C	8: 44,953,269	V1019A	possibly damaging	Het
Fbxl21	T	A	13: 56,527,017	H60Q	probably benign	Het
Fbxw7	A	C	3: 84,925,707	K19Q	possibly damaging	Het
Gldn	A	G	9: 54,338,662	K499R	possibly damaging	Het
Gm5514	T	G	19: 21,938,252		noncoding transcript	Het
Gria4	C	T	9: 4,513,295	M271I	probably benign	Het
Herc1	C	T	9: 66,445,640	T2136I	probably damaging	Het
Igsf10	A	G	3: 59,325,714	F1866S	probably benign	Het
Iqcg	G	T	16: 33,053,626		probably benign	Het
Itih2	A	T	2: 10,105,670	F537I	probably benign	Het
Itpr2	T	C	6: 146,382,700	D533G	probably damaging	Het
Kcnk15	A	G	2: 163,853,813	K22E	probably benign	Het
Lag3	A	T	6: 124,910,140	S155T	probably benign	Het
Lars	T	C	18: 42,212,602	E1003G	probably benign	Het
Layn	T	A	9: 51,059,544	N233I	probably damaging	Het
Lgi1	T	C	19: 38,306,246	Y465H	probably damaging	Het
Lrig1	C	T	6: 94,611,576	A531T	possibly damaging	Het
Lrrtm4	A	G	6: 80,019,655		probably benign	Het
Lsamp	T	A	16: 42,144,572	L264H	probably damaging	Het
Mthfd2	T	C	6: 83,313,475	E39G	probably damaging	Het
Mtx2	C	A	2: 74,847,262	A22E	probably damaging	Het
Nipal3	T	C	4: 135,463,846	T325A	probably damaging	Het
Nlrp14	A	T	7: 107,182,367	Y257F	probably benign	Het
Ola1	G	C	2: 73,156,860	R143G	probably damaging	Het
Olfr301	T	G	7: 86,412,633	I90M	probably damaging	Het
Otog	A	G	7: 46,288,368	T1834A	probably benign	Het
Oxr1	T	C	15: 41,848,701	I656T	probably damaging	Het
Panx1	GTTCTTCT	GTTCT	9: 15,006,171		probably benign	Het
Pcdh18	T	C	3: 49,754,791	S692G	probably benign	Het
Pcdhga1	A	G	18: 37,664,123	T727A	probably benign	Het
Pde9a	A	G	17: 31,448,427	E3G	possibly damaging	Het
Prl8a1	T	C	13: 27,579,733	E37G	probably damaging	Het
Rlf	C	T	4: 121,148,324	G1153D	probably benign	Het
Robo2	A	C	16: 73,920,747	L1159W	possibly damaging	Het
Sfxn5	T	C	6: 85,299,276		probably benign	Het
Siah2	A	G	3: 58,676,250	V205A	probably damaging	Het
Spindoc	A	C	19: 7,374,301	L202R	probably damaging	Het
Spock3	T	A	8: 63,345,699	D251E	probably damaging	Het
Srp68	T	A	11: 116,273,956	K51*	probably null	Het
Ssbp2	T	C	13: 91,524,607	Y29H	probably damaging	Het
Sspo	T	C	6: 48,449,930	V231A	probably damaging	Het
Stk4	T	A	2: 164,088,908	M143K	probably benign	Het
Tecta	C	T	9: 42,392,106	V77M	possibly damaging	Het
Trpc3	A	T	3: 36,638,559	D761E	probably benign	Het
Tubb2a	T	C	13: 34,075,264	E181G	probably damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Ush2a	C	A	1: 188,944,760	N4756K	probably benign	Het
Vmn2r-ps159	G	T	4: 156,334,397		noncoding transcript	Het
Wapl	G	A	14: 34,736,764	V928I	probably damaging	Het
Zfand3	A	G	17: 30,192,656	K130R	probably benign	Het
Zfp934	A	T	13: 62,517,785	H347Q	probably damaging	Het

Other mutations in Cntnap3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00433:Cntnap3	APN	13	64772731	missense	probably damaging	1.00
IGL00782:Cntnap3	APN	13	64745805	splice site	probably benign
IGL00976:Cntnap3	APN	13	64794352	missense	probably damaging	1.00
IGL01319:Cntnap3	APN	13	64787837	missense	probably damaging	1.00
IGL01610:Cntnap3	APN	13	64757301	missense	probably damaging	0.98
IGL01861:Cntnap3	APN	13	64799108	missense	probably damaging	1.00
IGL02127:Cntnap3	APN	13	64799064	splice site	probably benign
IGL02133:Cntnap3	APN	13	64751673	splice site	probably benign
IGL02251:Cntnap3	APN	13	64762036	missense	probably damaging	1.00
IGL02272:Cntnap3	APN	13	64757411	missense	probably damaging	1.00
IGL02370:Cntnap3	APN	13	64751751	missense	probably benign
IGL02456:Cntnap3	APN	13	64799058	splice site	probably benign
IGL02589:Cntnap3	APN	13	64792430	missense	probably benign	0.08
IGL02695:Cntnap3	APN	13	64772132	missense	probably benign	0.01
IGL02850:Cntnap3	APN	13	64757409	missense	probably damaging	1.00
IGL03038:Cntnap3	APN	13	64741025	missense	possibly damaging	0.50
IGL03188:Cntnap3	APN	13	64781745	missense	probably damaging	0.97
IGL03327:Cntnap3	APN	13	64887768	nonsense	probably null
PIT4480001:Cntnap3	UTSW	13	64757210	missense	probably damaging	1.00
R0309:Cntnap3	UTSW	13	64757436	splice site	probably benign
R0422:Cntnap3	UTSW	13	64757285	missense	probably damaging	0.96
R0463:Cntnap3	UTSW	13	64778876	missense	probably damaging	1.00
R0491:Cntnap3	UTSW	13	64762045	missense	probably benign	0.01
R0499:Cntnap3	UTSW	13	64858678	missense	probably benign	0.33
R0550:Cntnap3	UTSW	13	64762000	missense	possibly damaging	0.86
R0613:Cntnap3	UTSW	13	64758414	missense	probably damaging	1.00
R0666:Cntnap3	UTSW	13	64757397	missense	probably damaging	1.00
R0840:Cntnap3	UTSW	13	64787910	missense	possibly damaging	0.94
R1577:Cntnap3	UTSW	13	64758290	missense	probably damaging	1.00
R1716:Cntnap3	UTSW	13	64762002	missense	probably damaging	1.00
R1732:Cntnap3	UTSW	13	64740812	critical splice donor site	probably null
R1739:Cntnap3	UTSW	13	64740592	missense	probably benign	0.17
R1905:Cntnap3	UTSW	13	64903764	missense	probably benign	0.04
R1988:Cntnap3	UTSW	13	64758390	missense	probably damaging	1.00
R2086:Cntnap3	UTSW	13	64794262	missense	possibly damaging	0.76
R3808:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R3809:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R4384:Cntnap3	UTSW	13	64748460	missense	probably damaging	1.00
R4433:Cntnap3	UTSW	13	64778853	missense	possibly damaging	0.92
R4631:Cntnap3	UTSW	13	64778883	missense	probably benign	0.04
R4645:Cntnap3	UTSW	13	64778788	critical splice donor site	probably null
R4702:Cntnap3	UTSW	13	64778862	missense	probably benign	0.17
R4876:Cntnap3	UTSW	13	64787706	missense	probably benign	0.00
R4994:Cntnap3	UTSW	13	64761984	missense	possibly damaging	0.55
R5043:Cntnap3	UTSW	13	64794348	missense	probably damaging	1.00
R5214:Cntnap3	UTSW	13	64762010	missense	probably damaging	1.00
R5403:Cntnap3	UTSW	13	64761978	missense	possibly damaging	0.90
R5571:Cntnap3	UTSW	13	64903758	missense	probably damaging	0.98
R5587:Cntnap3	UTSW	13	64746738	missense	probably damaging	1.00
R5695:Cntnap3	UTSW	13	64787955	missense	probably damaging	0.99
R5834:Cntnap3	UTSW	13	64748577	missense	probably benign	0.07
R5892:Cntnap3	UTSW	13	64799180	missense	probably damaging	1.00
R5950:Cntnap3	UTSW	13	64787769	missense	probably damaging	1.00
R6526:Cntnap3	UTSW	13	64781888	missense	possibly damaging	0.96
R6954:Cntnap3	UTSW	13	64748559	missense	probably benign	0.00
R7138:Cntnap3	UTSW	13	64781725	critical splice donor site	probably null
R7355:Cntnap3	UTSW	13	64771962	missense	probably benign
R7425:Cntnap3	UTSW	13	64758252	missense	probably damaging	1.00
R7521:Cntnap3	UTSW	13	64772001	missense	probably benign	0.22
R7719:Cntnap3	UTSW	13	64772777	nonsense	probably null
R7810:Cntnap3	UTSW	13	64793308	missense	possibly damaging	0.73
R7871:Cntnap3	UTSW	13	64903773	missense	probably benign	0.00
R8259:Cntnap3	UTSW	13	64787867	missense	probably damaging	0.99
R8415:Cntnap3	UTSW	13	64738665	missense	probably benign	0.31
R8491:Cntnap3	UTSW	13	64785343	missense	probably damaging	1.00
R9086:Cntnap3	UTSW	13	64781759	missense	probably damaging	1.00
R9087:Cntnap3	UTSW	13	64751718	missense	probably damaging	0.96
R9398:Cntnap3	UTSW	13	64903834	missense	probably benign	0.41
R9475:Cntnap3	UTSW	13	64799135	missense	probably damaging	1.00
R9625:Cntnap3	UTSW	13	64858765	missense	probably damaging	1.00
R9679:Cntnap3	UTSW	13	64751748	missense	probably damaging	1.00
Z1176:Cntnap3	UTSW	13	64740872	frame shift	probably null
Z1176:Cntnap3	UTSW	13	64792388	missense	probably damaging	0.98
Z1177:Cntnap3	UTSW	13	64781892	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GGAGACTACACACCTGCATC -3'
(R):5'- TTACTAAGCTAACTTTGCCTCTGGG -3'

Sequencing Primer
(F):5'- ACCTGCATCCATAGAGGGC -3'
(R):5'- AACTTTGCCTCTGGGAGCCAC -3'

Posted On

2015-11-11