Incidental Mutation 'R3732:Pcdhga1'
ID356403
Institutional Source Beutler Lab
Gene Symbol Pcdhga1
Ensembl Gene ENSMUSG00000103144
Gene Nameprotocadherin gamma subfamily A, 1
Synonyms
MMRRC Submission 040720-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3732 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location37661793-37841873 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37664123 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 727 (T727A)
Ref Sequence ENSEMBL: ENSMUSP00000141367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115661] [ENSMUST00000193869] [ENSMUST00000194190] [ENSMUST00000194544] [ENSMUST00000194888]
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192137
Predicted Effect probably benign
Transcript: ENSMUST00000193869
SMART Domains Protein: ENSMUSP00000141482
Gene: ENSMUSG00000103332

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 45 131 1.64e-2 SMART
CA 155 240 6.42e-23 SMART
CA 264 345 1.76e-20 SMART
CA 369 450 2.27e-23 SMART
CA 474 560 1.5e-23 SMART
CA 591 669 1.17e-16 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194190
AA Change: T727A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000142062
Gene: ENSMUSG00000103144
AA Change: T727A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 31 131 3.16e-2 SMART
CA 155 240 5.39e-16 SMART
CA 264 345 6.72e-26 SMART
CA 369 450 1.32e-24 SMART
CA 474 560 4.17e-22 SMART
CA 591 669 4.48e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194328
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000194888
AA Change: T727A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000141367
Gene: ENSMUSG00000103144
AA Change: T727A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 31 131 1.6e-4 SMART
CA 155 240 2.7e-18 SMART
CA 264 345 3.3e-28 SMART
CA 369 450 6.7e-27 SMART
CA 474 560 2e-24 SMART
CA 591 669 2.2e-15 SMART
transmembrane domain 692 714 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 93% (56/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null/reporter allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik C T 11: 101,988,452 Q17* probably null Het
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Aacs C T 5: 125,506,262 T294M probably damaging Het
Ablim1 A T 19: 57,049,460 probably null Het
Adgrf4 C T 17: 42,672,581 G70E probably damaging Het
Adgrl3 C A 5: 81,794,946 H1474Q probably benign Het
Adgrv1 T C 13: 81,556,956 I1578M probably damaging Het
Afg3l1 G A 8: 123,501,233 G547D probably damaging Het
Ambra1 G A 2: 91,810,131 R635H probably damaging Het
Araf TACACACACACACACACA TACACACACACACACA X: 20,850,226 probably benign Het
Arhgef10l AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 4: 140,581,619 probably benign Het
Bcl7b A G 5: 135,180,913 T141A probably benign Het
Calm5 T A 13: 3,854,337 N10K probably damaging Het
Camsap1 T C 2: 25,938,344 R1123G probably damaging Het
Chrna3 T C 9: 55,015,894 K210R probably benign Het
Ciz1 A G 2: 32,367,483 N180S possibly damaging Het
Cntnap3 G A 13: 64,740,999 A1162V possibly damaging Het
Cox5b C T 1: 36,693,260 P114L probably damaging Het
Cpsf2 T C 12: 101,987,308 I199T probably damaging Het
Cyp2a4 A G 7: 26,312,827 D345G probably damaging Het
Cyp2s1 C T 7: 25,803,954 R424Q probably null Het
D1Pas1 C A 1: 186,968,097 S74R probably benign Het
Ddx4 T A 13: 112,611,982 I487F possibly damaging Het
Dnah5 A T 15: 28,409,122 E3562V possibly damaging Het
Dpf3 T C 12: 83,269,507 D330G possibly damaging Het
Edem1 T C 6: 108,841,621 F197L probably damaging Het
Ergic2 T C 6: 148,202,522 D79G probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fam102a G A 2: 32,566,292 S322N probably benign Het
Fam111a T C 19: 12,587,550 L221P possibly damaging Het
Fat1 T C 8: 44,953,269 V1019A possibly damaging Het
Fbxl21 T A 13: 56,527,017 H60Q probably benign Het
Fbxw7 A C 3: 84,925,707 K19Q possibly damaging Het
Gldn A G 9: 54,338,662 K499R possibly damaging Het
Gm5514 T G 19: 21,938,252 noncoding transcript Het
Gria4 C T 9: 4,513,295 M271I probably benign Het
Herc1 C T 9: 66,445,640 T2136I probably damaging Het
Igsf10 A G 3: 59,325,714 F1866S probably benign Het
Iqcg G T 16: 33,053,626 probably benign Het
Itih2 A T 2: 10,105,670 F537I probably benign Het
Itpr2 T C 6: 146,382,700 D533G probably damaging Het
Kcnk15 A G 2: 163,853,813 K22E probably benign Het
Lag3 A T 6: 124,910,140 S155T probably benign Het
Lars T C 18: 42,212,602 E1003G probably benign Het
Layn T A 9: 51,059,544 N233I probably damaging Het
Lgi1 T C 19: 38,306,246 Y465H probably damaging Het
Lrig1 C T 6: 94,611,576 A531T possibly damaging Het
Lrrtm4 A G 6: 80,019,655 probably benign Het
Lsamp T A 16: 42,144,572 L264H probably damaging Het
Mthfd2 T C 6: 83,313,475 E39G probably damaging Het
Mtx2 C A 2: 74,847,262 A22E probably damaging Het
Nipal3 T C 4: 135,463,846 T325A probably damaging Het
Nlrp14 A T 7: 107,182,367 Y257F probably benign Het
Ola1 G C 2: 73,156,860 R143G probably damaging Het
Olfr301 T G 7: 86,412,633 I90M probably damaging Het
Otog A G 7: 46,288,368 T1834A probably benign Het
Oxr1 T C 15: 41,848,701 I656T probably damaging Het
Panx1 GTTCTTCT GTTCT 9: 15,006,171 probably benign Het
Pcdh18 T C 3: 49,754,791 S692G probably benign Het
Pde9a A G 17: 31,448,427 E3G possibly damaging Het
Prl8a1 T C 13: 27,579,733 E37G probably damaging Het
Rlf C T 4: 121,148,324 G1153D probably benign Het
Robo2 A C 16: 73,920,747 L1159W possibly damaging Het
Sfxn5 T C 6: 85,299,276 probably benign Het
Siah2 A G 3: 58,676,250 V205A probably damaging Het
Spindoc A C 19: 7,374,301 L202R probably damaging Het
Spock3 T A 8: 63,345,699 D251E probably damaging Het
Srp68 T A 11: 116,273,956 K51* probably null Het
Ssbp2 T C 13: 91,524,607 Y29H probably damaging Het
Sspo T C 6: 48,449,930 V231A probably damaging Het
Stk4 T A 2: 164,088,908 M143K probably benign Het
Tecta C T 9: 42,392,106 V77M possibly damaging Het
Trpc3 A T 3: 36,638,559 D761E probably benign Het
Tubb2a T C 13: 34,075,264 E181G probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ush2a C A 1: 188,944,760 N4756K probably benign Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Wapl G A 14: 34,736,764 V928I probably damaging Het
Zfand3 A G 17: 30,192,656 K130R probably benign Het
Zfp934 A T 13: 62,517,785 H347Q probably damaging Het
Other mutations in Pcdhga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
BB009:Pcdhga1 UTSW 18 37663460 missense probably damaging 1.00
BB019:Pcdhga1 UTSW 18 37663460 missense probably damaging 1.00
R1074:Pcdhga1 UTSW 18 37825087 splice site probably benign
R1869:Pcdhga1 UTSW 18 37840090 missense probably damaging 0.98
R1871:Pcdhga1 UTSW 18 37840090 missense probably damaging 0.98
R3723:Pcdhga1 UTSW 18 37662992 missense possibly damaging 0.89
R4243:Pcdhga1 UTSW 18 37663552 missense probably damaging 1.00
R4245:Pcdhga1 UTSW 18 37663552 missense probably damaging 1.00
R4424:Pcdhga1 UTSW 18 37662579 missense probably damaging 0.97
R4898:Pcdhga1 UTSW 18 37662354 missense possibly damaging 0.63
R4941:Pcdhga1 UTSW 18 37662606 missense probably benign 0.10
R5021:Pcdhga1 UTSW 18 37663823 missense probably damaging 1.00
R5765:Pcdhga1 UTSW 18 37663661 missense probably benign 0.31
R6176:Pcdhga1 UTSW 18 37664229 missense probably benign 0.22
R6380:Pcdhga1 UTSW 18 37662969 missense probably damaging 1.00
R7062:Pcdhga1 UTSW 18 37825077 missense probably damaging 1.00
R7146:Pcdhga1 UTSW 18 37662111 missense probably benign 0.04
R7266:Pcdhga1 UTSW 18 37839975 missense possibly damaging 0.94
R7525:Pcdhga1 UTSW 18 37662228 missense probably damaging 1.00
R7553:Pcdhga1 UTSW 18 37749682 intron probably null
R7581:Pcdhga1 UTSW 18 37662177 missense probably damaging 1.00
R7932:Pcdhga1 UTSW 18 37663460 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTCACATTTACCATAGCAGTAG -3'
(R):5'- TTCAAGCAGAGACTGGGGTG -3'

Sequencing Primer
(F):5'- GCTGACAGCATCCCTGAC -3'
(R):5'- CTGGGGTGCTGACAAAAATTCCTG -3'
Posted On2015-11-11