Incidental Mutation 'R3732:Fam111a'
ID 356405
Institutional Source Beutler Lab
Gene Symbol Fam111a
Ensembl Gene ENSMUSG00000024691
Gene Name family with sequence similarity 111, member A
Synonyms 4632417K18Rik
MMRRC Submission 040720-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.060) question?
Stock # R3732 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 12550874-12567133 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 12564914 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 221 (L221P)
Ref Sequence ENSEMBL: ENSMUSP00000123598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025595] [ENSMUST00000144662] [ENSMUST00000151307]
AlphaFold Q9D2L9
Predicted Effect possibly damaging
Transcript: ENSMUST00000025595
AA Change: L265P

PolyPhen 2 Score 0.567 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000025595
Gene: ENSMUSG00000024691
AA Change: L265P

DomainStartEndE-ValueType
low complexity region 311 320 N/A INTRINSIC
Pfam:Trypsin 353 580 2.7e-7 PFAM
Pfam:Trypsin_2 368 557 6.4e-15 PFAM
Pfam:Peptidase_S7 491 574 6.9e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136697
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139270
Predicted Effect possibly damaging
Transcript: ENSMUST00000144662
AA Change: L265P

PolyPhen 2 Score 0.567 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000119518
Gene: ENSMUSG00000024691
AA Change: L265P

DomainStartEndE-ValueType
low complexity region 311 320 N/A INTRINSIC
Pfam:Trypsin 353 580 2.7e-7 PFAM
Pfam:Trypsin_2 355 557 1.3e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000151307
AA Change: L221P

PolyPhen 2 Score 0.567 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000123598
Gene: ENSMUSG00000024691
AA Change: L221P

DomainStartEndE-ValueType
low complexity region 267 276 N/A INTRINSIC
Pfam:Trypsin 309 536 6.6e-7 PFAM
Pfam:Trypsin_2 324 513 5.6e-15 PFAM
Pfam:Peptidase_S7 447 530 8.3e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224046
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 93% (56/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is cell-cycle regulated, and has nuclear localization. The C-terminal half of the protein shares homology with trypsin-like peptidases and it contains a PCNA-interacting peptide (PIP) box, that is necessary for its co-localization with proliferating cell nuclear antigen (PCNA). Reduced expression of this gene resulted in DNA replication defects, consistent with the demonstrated role for this gene in Simian Virus 40 (SV40) viral replication. Mutations in this gene have been associated with Kenny-Caffey syndrome (KCS) type 2 and the more severe osteocraniostenosis (OCS, also known as Gracile Bone Dysplasia), both characterized by short stature, hypoparathyroidism, bone development abnormalities, and hypocalcemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,684,980 (GRCm39) C172* probably null Het
Aacs C T 5: 125,583,326 (GRCm39) T294M probably damaging Het
Ablim1 A T 19: 57,037,892 (GRCm39) probably null Het
Adgrf4 C T 17: 42,983,472 (GRCm39) G70E probably damaging Het
Adgrl3 C A 5: 81,942,793 (GRCm39) H1474Q probably benign Het
Adgrv1 T C 13: 81,705,075 (GRCm39) I1578M probably damaging Het
Afg3l1 G A 8: 124,227,972 (GRCm39) G547D probably damaging Het
Ambra1 G A 2: 91,640,476 (GRCm39) R635H probably damaging Het
Araf TACACACACACACACACA TACACACACACACACA X: 20,716,465 (GRCm39) probably benign Het
Arhgef10l AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 4: 140,308,930 (GRCm39) probably benign Het
Bcl7b A G 5: 135,209,767 (GRCm39) T141A probably benign Het
Calm5 T A 13: 3,904,337 (GRCm39) N10K probably damaging Het
Camsap1 T C 2: 25,828,356 (GRCm39) R1123G probably damaging Het
Cfap97d1 C T 11: 101,879,278 (GRCm39) Q17* probably null Het
Chrna3 T C 9: 54,923,178 (GRCm39) K210R probably benign Het
Ciz1 A G 2: 32,257,495 (GRCm39) N180S possibly damaging Het
Cntnap3 G A 13: 64,888,813 (GRCm39) A1162V possibly damaging Het
Cox5b C T 1: 36,732,341 (GRCm39) P114L probably damaging Het
Cpsf2 T C 12: 101,953,567 (GRCm39) I199T probably damaging Het
Cyp2a4 A G 7: 26,012,252 (GRCm39) D345G probably damaging Het
Cyp2s1 C T 7: 25,503,379 (GRCm39) R424Q probably null Het
D1Pas1 C A 1: 186,700,294 (GRCm39) S74R probably benign Het
Ddx4 T A 13: 112,748,516 (GRCm39) I487F possibly damaging Het
Dnah5 A T 15: 28,409,268 (GRCm39) E3562V possibly damaging Het
Dpf3 T C 12: 83,316,281 (GRCm39) D330G possibly damaging Het
Edem1 T C 6: 108,818,582 (GRCm39) F197L probably damaging Het
Eeig1 G A 2: 32,456,304 (GRCm39) S322N probably benign Het
Ergic2 T C 6: 148,104,020 (GRCm39) D79G probably damaging Het
Espl1 A G 15: 102,221,424 (GRCm39) I944V probably damaging Het
Fat1 T C 8: 45,406,306 (GRCm39) V1019A possibly damaging Het
Fbxl21 T A 13: 56,674,830 (GRCm39) H60Q probably benign Het
Fbxw7 A C 3: 84,833,014 (GRCm39) K19Q possibly damaging Het
Gldn A G 9: 54,245,946 (GRCm39) K499R possibly damaging Het
Gria4 C T 9: 4,513,295 (GRCm39) M271I probably benign Het
Herc1 C T 9: 66,352,922 (GRCm39) T2136I probably damaging Het
Igsf10 A G 3: 59,233,135 (GRCm39) F1866S probably benign Het
Iqcg G T 16: 32,873,996 (GRCm39) probably benign Het
Itih2 A T 2: 10,110,481 (GRCm39) F537I probably benign Het
Itpr2 T C 6: 146,284,198 (GRCm39) D533G probably damaging Het
Kcnk15 A G 2: 163,695,733 (GRCm39) K22E probably benign Het
Lag3 A T 6: 124,887,103 (GRCm39) S155T probably benign Het
Lars1 T C 18: 42,345,667 (GRCm39) E1003G probably benign Het
Layn T A 9: 50,970,844 (GRCm39) N233I probably damaging Het
Ldhb-ps T G 19: 21,915,616 (GRCm39) noncoding transcript Het
Lgi1 T C 19: 38,294,694 (GRCm39) Y465H probably damaging Het
Lrig1 C T 6: 94,588,557 (GRCm39) A531T possibly damaging Het
Lrrtm4 A G 6: 79,996,638 (GRCm39) probably benign Het
Lsamp T A 16: 41,964,935 (GRCm39) L264H probably damaging Het
Mthfd2 T C 6: 83,290,457 (GRCm39) E39G probably damaging Het
Mtx2 C A 2: 74,677,606 (GRCm39) A22E probably damaging Het
Nipal3 T C 4: 135,191,157 (GRCm39) T325A probably damaging Het
Nlrp14 A T 7: 106,781,574 (GRCm39) Y257F probably benign Het
Ola1 G C 2: 72,987,204 (GRCm39) R143G probably damaging Het
Or14c44 T G 7: 86,061,841 (GRCm39) I90M probably damaging Het
Otog A G 7: 45,937,792 (GRCm39) T1834A probably benign Het
Oxr1 T C 15: 41,712,097 (GRCm39) I656T probably damaging Het
Panx1 GTTCTTCT GTTCT 9: 14,917,467 (GRCm39) probably benign Het
Pcdh18 T C 3: 49,709,240 (GRCm39) S692G probably benign Het
Pcdhga1 A G 18: 37,797,176 (GRCm39) T727A probably benign Het
Pde9a A G 17: 31,667,401 (GRCm39) E3G possibly damaging Het
Prl8a1 T C 13: 27,763,716 (GRCm39) E37G probably damaging Het
Rlf C T 4: 121,005,521 (GRCm39) G1153D probably benign Het
Robo2 A C 16: 73,717,635 (GRCm39) L1159W possibly damaging Het
Sfxn5 T C 6: 85,276,258 (GRCm39) probably benign Het
Siah2 A G 3: 58,583,671 (GRCm39) V205A probably damaging Het
Spindoc A C 19: 7,351,666 (GRCm39) L202R probably damaging Het
Spock3 T A 8: 63,798,733 (GRCm39) D251E probably damaging Het
Srp68 T A 11: 116,164,782 (GRCm39) K51* probably null Het
Ssbp2 T C 13: 91,672,726 (GRCm39) Y29H probably damaging Het
Sspo T C 6: 48,426,864 (GRCm39) V231A probably damaging Het
Stk4 T A 2: 163,930,828 (GRCm39) M143K probably benign Het
Tecta C T 9: 42,303,402 (GRCm39) V77M possibly damaging Het
Trpc3 A T 3: 36,692,708 (GRCm39) D761E probably benign Het
Tubb2a T C 13: 34,259,247 (GRCm39) E181G probably damaging Het
Ugcg C T 4: 59,207,798 (GRCm39) P46S probably benign Het
Ush2a C A 1: 188,676,957 (GRCm39) N4756K probably benign Het
Vmn2r129 G T 4: 156,686,692 (GRCm39) noncoding transcript Het
Wapl G A 14: 34,458,721 (GRCm39) V928I probably damaging Het
Zfand3 A G 17: 30,411,630 (GRCm39) K130R probably benign Het
Zfp934 A T 13: 62,665,599 (GRCm39) H347Q probably damaging Het
Other mutations in Fam111a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02565:Fam111a APN 19 12,564,318 (GRCm39) missense probably damaging 0.96
IGL02721:Fam111a APN 19 12,564,336 (GRCm39) missense probably benign 0.04
IGL02885:Fam111a APN 19 12,561,488 (GRCm39) critical splice donor site probably null
R0121:Fam111a UTSW 19 12,561,444 (GRCm39) missense probably benign 0.00
R0524:Fam111a UTSW 19 12,565,412 (GRCm39) missense probably damaging 1.00
R1553:Fam111a UTSW 19 12,564,682 (GRCm39) missense possibly damaging 0.93
R1583:Fam111a UTSW 19 12,565,142 (GRCm39) missense probably damaging 0.99
R1837:Fam111a UTSW 19 12,564,816 (GRCm39) missense probably benign 0.23
R2945:Fam111a UTSW 19 12,565,230 (GRCm39) nonsense probably null
R4772:Fam111a UTSW 19 12,565,057 (GRCm39) missense probably benign
R4773:Fam111a UTSW 19 12,565,772 (GRCm39) missense possibly damaging 0.91
R4894:Fam111a UTSW 19 12,565,913 (GRCm39) missense probably benign 0.12
R6177:Fam111a UTSW 19 12,564,746 (GRCm39) missense probably damaging 1.00
R6269:Fam111a UTSW 19 12,565,807 (GRCm39) missense probably benign 0.01
R6330:Fam111a UTSW 19 12,564,266 (GRCm39) missense probably damaging 1.00
R6390:Fam111a UTSW 19 12,565,524 (GRCm39) nonsense probably null
R6448:Fam111a UTSW 19 12,565,701 (GRCm39) missense probably benign 0.04
R6813:Fam111a UTSW 19 12,564,706 (GRCm39) missense probably damaging 1.00
R7620:Fam111a UTSW 19 12,565,301 (GRCm39) missense possibly damaging 0.73
R8291:Fam111a UTSW 19 12,564,943 (GRCm39) missense probably benign 0.01
X0010:Fam111a UTSW 19 12,565,592 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TATGGCTTCAAAGGAGAGACC -3'
(R):5'- ACCCTCGAAAGATGTTTGACC -3'

Sequencing Primer
(F):5'- GACCATCAGGGACACTCTGAG -3'
(R):5'- GATGTTTGACCACTTTAACAGGAG -3'
Posted On 2015-11-11