Incidental Mutation 'R4735:Tpr'
ID356419
Institutional Source Beutler Lab
Gene Symbol Tpr
Ensembl Gene ENSMUSG00000006005
Gene Nametranslocated promoter region, nuclear basket protein
Synonyms2610029M07Rik
MMRRC Submission 041962-MU
Accession Numbers

Genbank: NM_133780; MGI: 1922066

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4735 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location150392838-150449935 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 150442196 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 2152 (R2152C)
Ref Sequence ENSEMBL: ENSMUSP00000117616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119161] [ENSMUST00000124484] [ENSMUST00000124973]
Predicted Effect possibly damaging
Transcript: ENSMUST00000119161
AA Change: R2078C

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112606
Gene: ENSMUSG00000006005
AA Change: R2078C

DomainStartEndE-ValueType
coiled coil region 49 370 N/A INTRINSIC
coiled coil region 423 515 N/A INTRINSIC
low complexity region 518 534 N/A INTRINSIC
coiled coil region 539 604 N/A INTRINSIC
low complexity region 690 703 N/A INTRINSIC
low complexity region 782 795 N/A INTRINSIC
low complexity region 811 826 N/A INTRINSIC
low complexity region 1003 1019 N/A INTRINSIC
Pfam:TPR_MLP1_2 1036 1167 9.1e-33 PFAM
coiled coil region 1215 1421 N/A INTRINSIC
coiled coil region 1473 1629 N/A INTRINSIC
internal_repeat_3 1630 1691 1.48e-5 PROSPERO
low complexity region 1695 1717 N/A INTRINSIC
low complexity region 1761 1777 N/A INTRINSIC
internal_repeat_5 1814 1827 5.58e-5 PROSPERO
internal_repeat_3 1819 1881 1.48e-5 PROSPERO
internal_repeat_4 1875 1895 5.58e-5 PROSPERO
internal_repeat_1 1893 1919 2.03e-6 PROSPERO
low complexity region 1920 1933 N/A INTRINSIC
low complexity region 1942 1981 N/A INTRINSIC
low complexity region 1989 2014 N/A INTRINSIC
internal_repeat_4 2017 2036 5.58e-5 PROSPERO
low complexity region 2059 2078 N/A INTRINSIC
internal_repeat_2 2084 2135 3.95e-6 PROSPERO
internal_repeat_5 2127 2140 5.58e-5 PROSPERO
internal_repeat_1 2154 2179 2.03e-6 PROSPERO
internal_repeat_2 2156 2212 3.95e-6 PROSPERO
low complexity region 2239 2251 N/A INTRINSIC
low complexity region 2263 2277 N/A INTRINSIC
low complexity region 2292 2314 N/A INTRINSIC
low complexity region 2346 2357 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124484
SMART Domains Protein: ENSMUSP00000121991
Gene: ENSMUSG00000006005

DomainStartEndE-ValueType
low complexity region 26 38 N/A INTRINSIC
low complexity region 50 64 N/A INTRINSIC
low complexity region 79 101 N/A INTRINSIC
low complexity region 133 144 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000124973
AA Change: R2152C

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117616
Gene: ENSMUSG00000006005
AA Change: R2152C

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 24 77 N/A INTRINSIC
coiled coil region 123 444 N/A INTRINSIC
coiled coil region 497 589 N/A INTRINSIC
low complexity region 592 608 N/A INTRINSIC
coiled coil region 613 678 N/A INTRINSIC
low complexity region 764 777 N/A INTRINSIC
low complexity region 856 869 N/A INTRINSIC
low complexity region 885 900 N/A INTRINSIC
low complexity region 1077 1093 N/A INTRINSIC
Pfam:TPR_MLP1_2 1112 1240 5.1e-37 PFAM
coiled coil region 1289 1495 N/A INTRINSIC
low complexity region 1682 1698 N/A INTRINSIC
internal_repeat_5 1703 1750 8.04e-5 PROSPERO
internal_repeat_3 1704 1765 1.07e-5 PROSPERO
low complexity region 1769 1791 N/A INTRINSIC
low complexity region 1835 1851 N/A INTRINSIC
internal_repeat_5 1857 1900 8.04e-5 PROSPERO
internal_repeat_6 1887 1911 8.04e-5 PROSPERO
internal_repeat_3 1893 1955 1.07e-5 PROSPERO
internal_repeat_4 1949 1969 4.1e-5 PROSPERO
internal_repeat_1 1967 1993 1.42e-6 PROSPERO
low complexity region 1994 2007 N/A INTRINSIC
low complexity region 2016 2055 N/A INTRINSIC
low complexity region 2063 2088 N/A INTRINSIC
internal_repeat_4 2091 2110 4.1e-5 PROSPERO
internal_repeat_6 2108 2132 8.04e-5 PROSPERO
low complexity region 2133 2152 N/A INTRINSIC
internal_repeat_2 2158 2209 2.78e-6 PROSPERO
internal_repeat_1 2228 2253 1.42e-6 PROSPERO
internal_repeat_2 2230 2286 2.78e-6 PROSPERO
low complexity region 2313 2325 N/A INTRINSIC
low complexity region 2337 2351 N/A INTRINSIC
low complexity region 2366 2388 N/A INTRINSIC
low complexity region 2420 2431 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128417
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132257
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150752
Predicted Effect probably benign
Transcript: ENSMUST00000151563
SMART Domains Protein: ENSMUSP00000116012
Gene: ENSMUSG00000006005

DomainStartEndE-ValueType
coiled coil region 1 27 N/A INTRINSIC
coiled coil region 79 235 N/A INTRINSIC
low complexity region 302 324 N/A INTRINSIC
low complexity region 368 384 N/A INTRINSIC
low complexity region 527 540 N/A INTRINSIC
low complexity region 549 588 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152967
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large coiled-coil protein that forms intranuclear filaments attached to the inner surface of nuclear pore complexes (NPCs). The protein directly interacts with several components of the NPC. It is required for the nuclear export of mRNAs and some proteins. Oncogenic fusions of the 5' end of this gene with several different kinase genes occur in some neoplasias. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(28) : Targeted, other(2) Gene trapped(26)

Other mutations in this stock
Total: 133 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T A 12: 71,216,123 I1410N possibly damaging Het
4932411N23Rik T A X: 126,814,594 K296M probably damaging Het
4932438A13Rik T A 3: 37,004,967 N3267K possibly damaging Het
9230106D20Rik T C 10: 19,660,253 noncoding transcript Het
Acsf3 T A 8: 122,781,479 I238N probably damaging Het
Ahctf1 T C 1: 179,753,399 N1746S probably benign Het
Akap3 T C 6: 126,865,638 S407P probably damaging Het
Ankfy1 T A 11: 72,730,611 M241K probably benign Het
Ano7 C A 1: 93,400,494 T622K probably benign Het
App T C 16: 85,103,314 T83A probably damaging Het
Arhgef28 T A 13: 97,899,729 E1674V probably damaging Het
Asb2 C A 12: 103,325,058 V489L probably benign Het
Atrn T C 2: 131,020,990 V1330A probably benign Het
Brca1 A G 11: 101,492,175 probably null Het
Bspry G A 4: 62,486,525 R186Q probably damaging Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Celsr1 T A 15: 85,906,029 probably null Het
Ckap4 A G 10: 84,533,520 V116A possibly damaging Het
Crb3 A G 17: 57,065,207 T85A probably damaging Het
Cyld T C 8: 88,729,650 S443P probably damaging Het
Cyp27a1 T G 1: 74,737,207 V434G possibly damaging Het
Cyp2b13 A G 7: 26,088,295 T339A probably benign Het
Dars A T 1: 128,376,234 L252* probably null Het
Dcaf10 G A 4: 45,372,769 R394Q possibly damaging Het
Ddx55 T C 5: 124,566,476 F382S probably damaging Het
Dnah7b G A 1: 46,066,955 R33Q unknown Het
Dnm2 G T 9: 21,474,587 S302I probably damaging Het
Dock4 T A 12: 40,631,526 F75I probably benign Het
Dpp10 T C 1: 123,398,627 N365S probably benign Het
Dpy19l3 G T 7: 35,722,721 Q236K probably benign Het
Dsp T C 13: 38,196,040 S1655P probably damaging Het
Ebpl A T 14: 61,342,118 I117N probably damaging Het
Edc4 T A 8: 105,887,186 V386E probably damaging Het
Eif2s2 T A 2: 154,878,547 probably null Het
Elob A T 17: 23,827,588 probably null Het
Enox2 T C X: 49,069,677 I71V probably damaging Het
Fam160b1 A G 19: 57,371,229 E67G probably damaging Het
Fez1 A T 9: 36,860,845 K149* probably null Het
Fign A G 2: 63,980,438 Y163H probably damaging Het
Flnc G A 6: 29,455,813 G2048S probably damaging Het
Fras1 A G 5: 96,588,163 D539G probably benign Het
Frmd4b T C 6: 97,459,259 probably benign Het
Gan C T 8: 117,194,231 T402M probably damaging Het
Ganc T A 2: 120,436,623 silent Het
Ggt6 C A 11: 72,436,599 R103S probably benign Het
Gli2 T C 1: 118,840,322 D725G probably damaging Het
Gm15446 T A 5: 109,942,952 C357S probably damaging Het
Gm44501 A G 17: 40,578,919 N108S probably benign Het
Gm6309 A T 5: 146,168,244 D286E probably damaging Het
Gm6358 G A 16: 89,140,960 G29E unknown Het
Gm8251 A G 1: 44,061,701 I79T probably benign Het
Grik5 A G 7: 25,058,288 I422T probably damaging Het
Grin2c A G 11: 115,249,596 I1232T possibly damaging Het
Gsg1 C T 6: 135,237,407 R365H possibly damaging Het
H2-M2 A G 17: 37,483,244 S30P possibly damaging Het
Hcfc2 A G 10: 82,712,080 D302G probably damaging Het
Hk2 T C 6: 82,744,974 D128G probably benign Het
Hmcn2 C A 2: 31,383,775 Q1380K probably benign Het
Hsp90b1 G T 10: 86,693,955 P617T probably damaging Het
Htr1d A G 4: 136,442,886 E142G probably benign Het
Hydin G A 8: 110,555,632 probably null Het
Il1r1 T A 1: 40,293,295 N81K probably benign Het
Inpp5b T C 4: 124,783,967 S407P probably damaging Het
Itpkb T C 1: 180,418,215 Y766H probably damaging Het
Lyrm2 T A 4: 32,801,150 I65N probably damaging Het
Mink1 T A 11: 70,609,260 probably null Het
Mkrn3 C T 7: 62,419,704 R113H probably damaging Het
Msx3 G A 7: 140,047,885 A157V probably damaging Het
Nrxn2 T G 19: 6,498,454 V59G possibly damaging Het
Nt5c3b T C 11: 100,440,906 T12A probably benign Het
Nwd2 G A 5: 63,808,251 R1726Q probably benign Het
Nynrin A G 14: 55,870,168 T911A probably benign Het
Olfr1179 T C 2: 88,402,923 T4A probably benign Het
Olfr266 T A 3: 106,821,680 Y293F probably damaging Het
Olfr490 A G 7: 108,286,313 M271T probably benign Het
Olfr609 C T 7: 103,492,060 V273M possibly damaging Het
Olfr611 A G 7: 103,517,823 I187T possibly damaging Het
Olfr659 C T 7: 104,670,993 T97I probably benign Het
Olfr805 A G 10: 129,722,923 I207T probably benign Het
Patl1 G T 19: 11,922,505 M220I probably benign Het
Pcnx2 A T 8: 125,828,041 probably null Het
Pigr A T 1: 130,846,554 T424S probably damaging Het
Pik3c2b T A 1: 133,067,049 D250E probably benign Het
Ppa2 G A 3: 133,370,425 E272K probably benign Het
Pramel7 G A 2: 87,490,843 Q283* probably null Het
Prelid3b A G 2: 174,465,890 I81T probably benign Het
Prpf38a T C 4: 108,579,045 I24V possibly damaging Het
Ptger2 A G 14: 45,001,838 D311G possibly damaging Het
Rab4b A T 7: 27,172,766 probably benign Het
Rad17 A C 13: 100,619,129 D581E probably damaging Het
Samd11 T C 4: 156,248,773 T333A probably benign Het
Scaf4 C T 16: 90,252,432 D256N unknown Het
Serinc2 A G 4: 130,263,645 F82L probably benign Het
Serpina3g T A 12: 104,239,113 V37E probably damaging Het
Serpinb9c T A 13: 33,150,271 M263L probably benign Het
Shbg A G 11: 69,617,500 I67T possibly damaging Het
Slc25a48 G A 13: 56,449,074 probably null Het
Slc25a54 T C 3: 109,098,607 W144R probably damaging Het
Slc34a1 A T 13: 55,413,584 T621S probably benign Het
Slc6a18 A T 13: 73,666,435 C419S probably benign Het
Smc5 A T 19: 23,242,705 D389E probably benign Het
Smco3 T A 6: 136,831,638 E79D probably damaging Het
Sox5 A G 6: 143,960,835 F298S probably damaging Het
Sphkap A G 1: 83,279,117 S304P probably benign Het
Tcea2 C T 2: 181,686,721 T211I probably damaging Het
Tcf4 G T 18: 69,564,155 S34I possibly damaging Het
Tlr4 C T 4: 66,841,198 R743C probably damaging Het
Tmem183a T C 1: 134,360,882 E67G probably damaging Het
Trbv15 T C 6: 41,141,424 I38T probably benign Het
Treh G A 9: 44,681,552 A125T probably damaging Het
Trio A T 15: 27,752,789 probably null Het
Ttn A G 2: 76,951,949 V981A probably damaging Het
Uap1l1 A G 2: 25,362,720 L436P probably damaging Het
Uba7 A T 9: 107,976,916 I182F possibly damaging Het
Unc13c A T 9: 73,693,338 S1375T probably benign Het
Usp48 C CT 4: 137,633,369 probably null Het
Utp20 A C 10: 88,816,918 V378G possibly damaging Het
Vmn1r69 A T 7: 10,580,999 probably benign Het
Vmn1r86 A T 7: 13,102,294 H218Q probably damaging Het
Vmn2r121 T A X: 124,128,638 I562L probably benign Het
Vmn2r45 A T 7: 8,483,473 I272N probably damaging Het
Wdr90 A G 17: 25,859,450 V320A probably benign Het
Wfikkn1 A G 17: 25,878,393 V319A possibly damaging Het
Whamm A G 7: 81,571,374 D18G probably benign Het
Wrn T A 8: 33,285,222 I605F probably damaging Het
Zdhhc18 A G 4: 133,613,867 F232L probably damaging Het
Zfp41 T C 15: 75,618,760 I187T probably benign Het
Zfp418 A G 7: 7,182,562 Y508C probably damaging Het
Zfp560 T G 9: 20,349,051 I172L probably benign Het
Zfp943 A T 17: 21,992,410 D159V probably benign Het
Zfp955a T C 17: 33,241,722 I479V probably benign Het
Zfpm1 T A 8: 122,335,480 V426D probably benign Het
Zic1 C T 9: 91,364,505 M171I possibly damaging Het
Other mutations in Tpr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Tpr APN 1 150423696 splice site probably benign
IGL00424:Tpr APN 1 150398595 splice site probably benign
IGL01095:Tpr APN 1 150410140 missense possibly damaging 0.95
IGL01347:Tpr APN 1 150426987 missense probably damaging 1.00
IGL01519:Tpr APN 1 150431168 missense probably benign 0.01
IGL01768:Tpr APN 1 150444448 missense possibly damaging 0.85
IGL01939:Tpr APN 1 150413745 missense possibly damaging 0.82
IGL01988:Tpr APN 1 150426999 splice site probably null
IGL02065:Tpr APN 1 150413774 missense probably benign 0.13
IGL02110:Tpr APN 1 150435742 missense probably damaging 0.97
IGL02311:Tpr APN 1 150398653 missense probably damaging 0.97
IGL02454:Tpr APN 1 150431192 missense probably benign 0.00
IGL02569:Tpr APN 1 150425631 unclassified probably benign
IGL03168:Tpr APN 1 150408757 missense probably benign 0.04
IGL03193:Tpr APN 1 150440080 missense possibly damaging 0.85
IGL03333:Tpr APN 1 150426967 missense probably benign 0.04
F6893:Tpr UTSW 1 150393562 missense possibly damaging 0.84
PIT4305001:Tpr UTSW 1 150440137 missense possibly damaging 0.85
PIT4469001:Tpr UTSW 1 150403956 missense probably benign 0.41
R0085:Tpr UTSW 1 150417413 missense possibly damaging 0.95
R0101:Tpr UTSW 1 150409302 splice site probably benign
R0116:Tpr UTSW 1 150410147 missense probably damaging 0.98
R0136:Tpr UTSW 1 150430595 missense probably benign 0.01
R0207:Tpr UTSW 1 150417427 missense possibly damaging 0.74
R0219:Tpr UTSW 1 150443258 splice site probably null
R0380:Tpr UTSW 1 150412947 missense probably benign 0.27
R0403:Tpr UTSW 1 150407414 splice site probably benign
R0469:Tpr UTSW 1 150423667 frame shift probably null
R0480:Tpr UTSW 1 150428241 missense possibly damaging 0.83
R0514:Tpr UTSW 1 150402273 missense possibly damaging 0.55
R0563:Tpr UTSW 1 150408858 missense probably benign 0.13
R0631:Tpr UTSW 1 150422531 missense probably damaging 0.98
R0685:Tpr UTSW 1 150433725 missense possibly damaging 0.69
R0730:Tpr UTSW 1 150393407 utr 5 prime probably benign
R0739:Tpr UTSW 1 150407497 missense possibly damaging 0.94
R0780:Tpr UTSW 1 150431341 missense probably benign 0.00
R1018:Tpr UTSW 1 150442183 missense possibly damaging 0.53
R1084:Tpr UTSW 1 150442161 missense probably benign 0.18
R1532:Tpr UTSW 1 150418000 missense probably damaging 0.99
R1551:Tpr UTSW 1 150436801 missense probably benign 0.00
R1608:Tpr UTSW 1 150426893 missense probably damaging 0.96
R1759:Tpr UTSW 1 150429524 missense probably benign 0.19
R1817:Tpr UTSW 1 150419903 missense probably damaging 0.98
R1932:Tpr UTSW 1 150421663 missense probably benign 0.00
R1978:Tpr UTSW 1 150419907 missense possibly damaging 0.65
R2031:Tpr UTSW 1 150442119 missense probably benign
R2176:Tpr UTSW 1 150419940 missense possibly damaging 0.56
R2235:Tpr UTSW 1 150442092 missense probably benign 0.33
R2339:Tpr UTSW 1 150413774 missense probably benign 0.01
R2367:Tpr UTSW 1 150433728 missense probably damaging 0.99
R2507:Tpr UTSW 1 150392944 start codon destroyed probably null
R3931:Tpr UTSW 1 150435904 missense probably damaging 1.00
R4320:Tpr UTSW 1 150423574 missense possibly damaging 0.96
R4439:Tpr UTSW 1 150403961 missense probably benign 0.01
R4568:Tpr UTSW 1 150392959 unclassified probably benign
R4644:Tpr UTSW 1 150423499 missense probably benign 0.01
R4665:Tpr UTSW 1 150444399 missense probably damaging 0.97
R4672:Tpr UTSW 1 150423567 missense probably benign 0.45
R4673:Tpr UTSW 1 150423567 missense probably benign 0.45
R4767:Tpr UTSW 1 150430529 intron probably benign
R4772:Tpr UTSW 1 150413113 missense possibly damaging 0.46
R4815:Tpr UTSW 1 150398608 missense probably benign 0.01
R4839:Tpr UTSW 1 150449197 nonsense probably null
R4844:Tpr UTSW 1 150445879 missense possibly damaging 0.86
R4925:Tpr UTSW 1 150432565 missense probably benign 0.00
R4967:Tpr UTSW 1 150410059 missense probably damaging 0.99
R5017:Tpr UTSW 1 150398637 missense probably benign 0.00
R5096:Tpr UTSW 1 150446202 missense probably damaging 0.99
R5353:Tpr UTSW 1 150445924 missense probably damaging 1.00
R5354:Tpr UTSW 1 150445924 missense probably damaging 1.00
R5484:Tpr UTSW 1 150426888 missense probably benign 0.33
R5601:Tpr UTSW 1 150435853 missense possibly damaging 0.75
R5642:Tpr UTSW 1 150423818 missense probably damaging 0.99
R5779:Tpr UTSW 1 150423541 missense probably damaging 1.00
R5787:Tpr UTSW 1 150395286 missense probably benign 0.01
R5892:Tpr UTSW 1 150407400 missense probably benign 0.44
R5915:Tpr UTSW 1 150425649 missense probably benign 0.15
R5928:Tpr UTSW 1 150428127 missense probably benign 0.30
R6146:Tpr UTSW 1 150423162 missense possibly damaging 0.83
R6154:Tpr UTSW 1 150423816 missense probably benign 0.00
R6234:Tpr UTSW 1 150418039 missense probably benign 0.02
R6263:Tpr UTSW 1 150442245 critical splice donor site probably null
R6318:Tpr UTSW 1 150445888 missense possibly damaging 0.93
R6550:Tpr UTSW 1 150423977 missense probably damaging 1.00
R6592:Tpr UTSW 1 150411905 missense possibly damaging 0.83
R6704:Tpr UTSW 1 150406508 missense possibly damaging 0.80
R6716:Tpr UTSW 1 150414765 missense probably damaging 1.00
R6836:Tpr UTSW 1 150436673 intron probably null
R6886:Tpr UTSW 1 150423965 missense probably benign 0.00
R6894:Tpr UTSW 1 150436847 missense probably benign 0.28
R6928:Tpr UTSW 1 150408785 missense possibly damaging 0.83
R7011:Tpr UTSW 1 150433772 missense probably damaging 1.00
R7034:Tpr UTSW 1 150423607 missense probably benign 0.02
R7036:Tpr UTSW 1 150423607 missense probably benign 0.02
R7183:Tpr UTSW 1 150406551 missense probably damaging 1.00
R7221:Tpr UTSW 1 150446178 missense possibly damaging 0.96
R7223:Tpr UTSW 1 150439256 missense possibly damaging 0.53
R7294:Tpr UTSW 1 150403887 missense probably damaging 1.00
R7343:Tpr UTSW 1 150393494 missense unknown
R7361:Tpr UTSW 1 150447621 missense possibly damaging 0.73
R7405:Tpr UTSW 1 150442127 missense probably benign 0.02
R7637:Tpr UTSW 1 150423516 missense probably damaging 1.00
R7720:Tpr UTSW 1 150429532 missense possibly damaging 0.49
R7721:Tpr UTSW 1 150444429 missense probably benign
X0021:Tpr UTSW 1 150395207 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATGTGATTTCATAGTCTGGGC -3'
(R):5'- TCACACTCAGAAACTGGAGATTAG -3'

Sequencing Primer
(F):5'- GCTTGGTTTCCAAACTGAAGTC -3'
(R):5'- AGTAGTATCTTACAACATGCC -3'
Posted On2015-11-11