Incidental Mutation 'R0402:Chkb'
ID35643
Institutional Source Beutler Lab
Gene Symbol Chkb
Ensembl Gene ENSMUSG00000022617
Gene Namecholine kinase beta
SynonymsChetk, Chkl, CK/EK-beta
MMRRC Submission 038607-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.644) question?
Stock #R0402 (G1)
Quality Score86
Status Validated
Chromosome15
Chromosomal Location89426360-89429908 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 89429407 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 65 (R65Q)
Ref Sequence ENSEMBL: ENSMUSP00000154958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023289] [ENSMUST00000052315] [ENSMUST00000109313] [ENSMUST00000168376] [ENSMUST00000168646] [ENSMUST00000170460] [ENSMUST00000171666]
Predicted Effect probably benign
Transcript: ENSMUST00000023289
AA Change: R65Q

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000023289
Gene: ENSMUSG00000022617
AA Change: R65Q

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:APH 70 317 1.9e-14 PFAM
Pfam:Choline_kinase 97 308 1.5e-76 PFAM
low complexity region 324 344 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000052315
AA Change: R65Q

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000109313
SMART Domains Protein: ENSMUSP00000104936
Gene: ENSMUSG00000078937

DomainStartEndE-ValueType
Pfam:CPT_N 1 47 2.5e-29 PFAM
Pfam:Carn_acyltransf 173 762 1.3e-183 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000112664
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115278
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165623
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166267
Predicted Effect probably benign
Transcript: ENSMUST00000168376
SMART Domains Protein: ENSMUSP00000129786
Gene: ENSMUSG00000078937

DomainStartEndE-ValueType
PDB:2LE3|A 1 42 1e-21 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000168646
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170334
Predicted Effect probably benign
Transcript: ENSMUST00000170460
SMART Domains Protein: ENSMUSP00000128026
Gene: ENSMUSG00000022617

DomainStartEndE-ValueType
Pfam:Choline_kinase 1 176 1e-65 PFAM
Pfam:APH 8 176 6.1e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171140
Predicted Effect probably benign
Transcript: ENSMUST00000171666
SMART Domains Protein: ENSMUSP00000127191
Gene: ENSMUSG00000022617

DomainStartEndE-ValueType
Pfam:Choline_kinase 1 142 2.5e-51 PFAM
Pfam:APH 1 149 6.9e-14 PFAM
Pfam:EcKinase 2 116 8.8e-8 PFAM
Meta Mutation Damage Score 0.0516 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.0%
  • 10x: 94.5%
  • 20x: 88.7%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Choline kinase (CK) and ethanolamine kinase (EK) catalyze the phosphorylation of choline/ethanolamine to phosphocholine/phosphoethanolamine. This is the first enzyme in the biosynthesis of phosphatidylcholine/phosphatidylethanolamine in all animal cells. The highly purified CKs from mammalian sources and their recombinant gene products have been shown to have EK activity also, indicating that both activities reside on the same protein. The choline kinase-like protein encoded by CHKL belongs to the choline/ethanolamine kinase family; however, its exact function is not known. Read-through transcripts are expressed from this locus that include exons from the downstream CPT1B locus. [provided by RefSeq, Jun 2009]
PHENOTYPE: Homozygous null mice display progressive muscular weakness and dystrophy in the hindlimbs but have normal nerve and neuromuscular junction morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A T 10: 100,609,253 K165N probably damaging Het
Adam6b T A 12: 113,489,995 M144K probably damaging Het
Arhgap44 T C 11: 65,032,077 probably benign Het
Arl5c T A 11: 97,995,113 I21F probably damaging Het
Bglap2 C T 3: 88,378,245 G40D probably damaging Het
Bptf T C 11: 107,074,114 E1303G probably damaging Het
Calhm1 T C 19: 47,141,457 T209A probably damaging Het
Ccr8 A G 9: 120,094,910 probably null Het
Col4a1 T C 8: 11,199,838 probably benign Het
Cryzl2 A G 1: 157,464,444 T98A probably benign Het
D430041D05Rik T C 2: 104,168,164 T1080A probably damaging Het
Dhx8 C A 11: 101,752,397 T765N probably damaging Het
Dicer1 T C 12: 104,731,064 D78G probably benign Het
Drd2 A G 9: 49,404,971 I344V probably benign Het
Edil3 A T 13: 89,199,451 probably benign Het
Fam71a T C 1: 191,164,440 D2G probably benign Het
Fam71f1 A G 6: 29,323,902 T209A probably benign Het
Fbxw19 C T 9: 109,484,425 G235D probably benign Het
Fzd1 T C 5: 4,755,702 K627E possibly damaging Het
Gm10638 A G 8: 86,746,200 probably benign Het
Gm14124 T A 2: 150,269,216 C609S possibly damaging Het
H6pd G T 4: 149,996,316 A24E probably damaging Het
Hectd2 G T 19: 36,601,529 probably null Het
Hps5 A G 7: 46,790,909 probably benign Het
Irx3 T C 8: 91,800,668 N136S possibly damaging Het
Kcmf1 T C 6: 72,849,585 M1V probably null Het
Klrb1 A T 6: 128,710,620 F104I probably benign Het
Lrfn5 T C 12: 61,840,017 M197T probably benign Het
Mpdz A C 4: 81,361,440 M51R possibly damaging Het
Mtbp G T 15: 55,569,070 E258* probably null Het
Mylk3 T A 8: 85,352,910 H373L probably damaging Het
Myrfl A G 10: 116,828,977 S383P probably damaging Het
Nt5c T C 11: 115,490,642 *195W probably null Het
Ocstamp A G 2: 165,396,264 V360A possibly damaging Het
Olfr1180 A T 2: 88,412,034 V208D probably damaging Het
Olfr122 T A 17: 37,772,393 C247S probably damaging Het
Olfr1277 A G 2: 111,269,863 F168S probably damaging Het
Olfr1330 A T 4: 118,893,229 I49F possibly damaging Het
Olfr1431 A G 19: 12,209,589 T8A probably damaging Het
Otop2 T C 11: 115,326,408 probably benign Het
Pom121l2 A T 13: 21,988,479 probably benign Het
Pon2 T A 6: 5,272,410 K137* probably null Het
Ppip5k2 T A 1: 97,719,854 Q1049L probably benign Het
Ralgapa2 C T 2: 146,434,809 V504M probably damaging Het
Rph3a G A 5: 120,942,254 H654Y probably damaging Het
Sh2d1b1 T C 1: 170,279,773 probably benign Het
Slc15a2 G A 16: 36,775,598 T154I probably benign Het
Slc45a3 T C 1: 131,977,527 V96A possibly damaging Het
Slc7a4 A G 16: 17,575,633 S101P probably damaging Het
Smco2 T C 6: 146,871,135 probably benign Het
Spata2 A T 2: 167,483,660 V413E probably benign Het
Specc1l A G 10: 75,246,426 E552G probably damaging Het
Sstr5 C T 17: 25,492,034 V74M probably benign Het
Timm50 G A 7: 28,306,855 R274W probably damaging Het
Tll2 A G 19: 41,098,693 V573A possibly damaging Het
Tm7sf3 C A 6: 146,606,187 R459M possibly damaging Het
Txk A G 5: 72,731,762 probably null Het
Uroc1 A G 6: 90,347,302 D436G probably damaging Het
Vmn1r13 T A 6: 57,210,098 Y81N possibly damaging Het
Vmn2r19 A G 6: 123,336,182 E737G probably damaging Het
Wfs1 A G 5: 36,976,980 probably benign Het
Zfp1 G A 8: 111,670,243 E285K probably damaging Het
Zfp661 G A 2: 127,577,720 Q167* probably null Het
Zswim8 T C 14: 20,710,766 F36S probably damaging Het
Zw10 A G 9: 49,068,723 T385A probably benign Het
Other mutations in Chkb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00661:Chkb APN 15 89427591 missense probably benign 0.05
IGL00922:Chkb APN 15 89422288 critical splice donor site probably null
IGL00943:Chkb APN 15 89428748 missense probably damaging 1.00
IGL01415:Chkb APN 15 89428784 missense probably damaging 1.00
IGL01537:Chkb APN 15 89427783 splice site probably benign
IGL01710:Chkb APN 15 89426640 nonsense probably null
IGL01720:Chkb APN 15 89427952 splice site probably null
IGL02725:Chkb APN 15 89429137 missense probably damaging 1.00
R1779:Chkb UTSW 15 89429057 missense possibly damaging 0.76
R2001:Chkb UTSW 15 89428766 missense probably damaging 1.00
R4999:Chkb UTSW 15 89428165 missense probably damaging 1.00
R5452:Chkb UTSW 15 89429585 unclassified probably benign
R5822:Chkb UTSW 15 89429512 missense probably benign 0.22
R6820:Chkb UTSW 15 89428176 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCGAACTCCCAAGTTACGATCC -3'
(R):5'- GTTAAACCTAACGGAGCCCACGTC -3'

Sequencing Primer
(F):5'- TAGAGTCGTAGCAGCACCTC -3'
(R):5'- ACGGGACAGGGGTAGTC -3'
Posted On2013-05-09