Incidental Mutation 'R0402:Sstr5'
ID35646
Institutional Source Beutler Lab
Gene Symbol Sstr5
Ensembl Gene ENSMUSG00000050824
Gene Namesomatostatin receptor 5
SynonymsSmstr5, sst5
MMRRC Submission 038607-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R0402 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location25489875-25497288 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 25492034 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 74 (V74M)
Ref Sequence ENSEMBL: ENSMUSP00000128787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051864] [ENSMUST00000165183]
Predicted Effect probably benign
Transcript: ENSMUST00000051864
AA Change: V74M

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000051085
Gene: ENSMUSG00000050824
AA Change: V74M

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
Pfam:7TM_GPCR_Srv 44 320 1.3e-9 PFAM
Pfam:7TM_GPCR_Srx 45 317 5.5e-10 PFAM
Pfam:7TM_GPCR_Srsx 48 318 1.3e-19 PFAM
Pfam:7tm_1 54 303 3.1e-64 PFAM
Pfam:7TM_GPCR_Srw 195 321 1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165183
AA Change: V74M

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000128787
Gene: ENSMUSG00000050824
AA Change: V74M

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
Pfam:7TM_GPCR_Srv 44 320 1.9e-9 PFAM
Pfam:7TM_GPCR_Srx 45 317 3.5e-10 PFAM
Pfam:7TM_GPCR_Srsx 48 318 1.3e-19 PFAM
Pfam:7tm_1 54 303 1.9e-71 PFAM
Pfam:7TM_GPCR_Srw 195 321 1e-8 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.0%
  • 10x: 94.5%
  • 20x: 88.7%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Somatostatin and its related peptide cortistatin exert multiple biological actions on normal and tumoral tissue targets by interacting with somatostatin receptors (SSTRs). The protein encoded by this gene is one of the SSTRs, which is a multi-pass membrane protein and belongs to the G-protein coupled receptor 1 family. The activity of this receptor is mediated by G proteins which inhibit adenylyl cyclase, and different regions of this receptor molecule are required for the activation of different signaling pathways. A mutation in this gene results in somatostatin analog resistance. Alternatively spliced transcript variants have been identified in this gene.[provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygotes for one null allele display decreased numbers of insulin positive cells in the pancreas. Homozygotes for a second null allele have normal pancreatic islet morphology but increased insulin secretion, decreased blood insulin and glucose levels,and improved glucose tolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A T 10: 100,609,253 K165N probably damaging Het
Adam6b T A 12: 113,489,995 M144K probably damaging Het
Arhgap44 T C 11: 65,032,077 probably benign Het
Arl5c T A 11: 97,995,113 I21F probably damaging Het
Bglap2 C T 3: 88,378,245 G40D probably damaging Het
Bptf T C 11: 107,074,114 E1303G probably damaging Het
Calhm1 T C 19: 47,141,457 T209A probably damaging Het
Ccr8 A G 9: 120,094,910 probably null Het
Chkb C T 15: 89,429,407 R65Q probably benign Het
Col4a1 T C 8: 11,199,838 probably benign Het
Cryzl2 A G 1: 157,464,444 T98A probably benign Het
D430041D05Rik T C 2: 104,168,164 T1080A probably damaging Het
Dhx8 C A 11: 101,752,397 T765N probably damaging Het
Dicer1 T C 12: 104,731,064 D78G probably benign Het
Drd2 A G 9: 49,404,971 I344V probably benign Het
Edil3 A T 13: 89,199,451 probably benign Het
Fam71a T C 1: 191,164,440 D2G probably benign Het
Fam71f1 A G 6: 29,323,902 T209A probably benign Het
Fbxw19 C T 9: 109,484,425 G235D probably benign Het
Fzd1 T C 5: 4,755,702 K627E possibly damaging Het
Gm10638 A G 8: 86,746,200 probably benign Het
Gm14124 T A 2: 150,269,216 C609S possibly damaging Het
H6pd G T 4: 149,996,316 A24E probably damaging Het
Hectd2 G T 19: 36,601,529 probably null Het
Hps5 A G 7: 46,790,909 probably benign Het
Irx3 T C 8: 91,800,668 N136S possibly damaging Het
Kcmf1 T C 6: 72,849,585 M1V probably null Het
Klrb1 A T 6: 128,710,620 F104I probably benign Het
Lrfn5 T C 12: 61,840,017 M197T probably benign Het
Mpdz A C 4: 81,361,440 M51R possibly damaging Het
Mtbp G T 15: 55,569,070 E258* probably null Het
Mylk3 T A 8: 85,352,910 H373L probably damaging Het
Myrfl A G 10: 116,828,977 S383P probably damaging Het
Nt5c T C 11: 115,490,642 *195W probably null Het
Ocstamp A G 2: 165,396,264 V360A possibly damaging Het
Olfr1180 A T 2: 88,412,034 V208D probably damaging Het
Olfr122 T A 17: 37,772,393 C247S probably damaging Het
Olfr1277 A G 2: 111,269,863 F168S probably damaging Het
Olfr1330 A T 4: 118,893,229 I49F possibly damaging Het
Olfr1431 A G 19: 12,209,589 T8A probably damaging Het
Otop2 T C 11: 115,326,408 probably benign Het
Pom121l2 A T 13: 21,988,479 probably benign Het
Pon2 T A 6: 5,272,410 K137* probably null Het
Ppip5k2 T A 1: 97,719,854 Q1049L probably benign Het
Ralgapa2 C T 2: 146,434,809 V504M probably damaging Het
Rph3a G A 5: 120,942,254 H654Y probably damaging Het
Sh2d1b1 T C 1: 170,279,773 probably benign Het
Slc15a2 G A 16: 36,775,598 T154I probably benign Het
Slc45a3 T C 1: 131,977,527 V96A possibly damaging Het
Slc7a4 A G 16: 17,575,633 S101P probably damaging Het
Smco2 T C 6: 146,871,135 probably benign Het
Spata2 A T 2: 167,483,660 V413E probably benign Het
Specc1l A G 10: 75,246,426 E552G probably damaging Het
Timm50 G A 7: 28,306,855 R274W probably damaging Het
Tll2 A G 19: 41,098,693 V573A possibly damaging Het
Tm7sf3 C A 6: 146,606,187 R459M possibly damaging Het
Txk A G 5: 72,731,762 probably null Het
Uroc1 A G 6: 90,347,302 D436G probably damaging Het
Vmn1r13 T A 6: 57,210,098 Y81N possibly damaging Het
Vmn2r19 A G 6: 123,336,182 E737G probably damaging Het
Wfs1 A G 5: 36,976,980 probably benign Het
Zfp1 G A 8: 111,670,243 E285K probably damaging Het
Zfp661 G A 2: 127,577,720 Q167* probably null Het
Zswim8 T C 14: 20,710,766 F36S probably damaging Het
Zw10 A G 9: 49,068,723 T385A probably benign Het
Other mutations in Sstr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01532:Sstr5 APN 17 25491331 missense probably damaging 1.00
IGL01738:Sstr5 APN 17 25491610 missense probably damaging 1.00
IGL02212:Sstr5 APN 17 25491673 missense possibly damaging 0.93
IGL03098:Sstr5 UTSW 17 25491277 missense probably benign 0.00
R1576:Sstr5 UTSW 17 25491298 missense possibly damaging 0.94
R2354:Sstr5 UTSW 17 25491901 missense probably benign 0.29
R4392:Sstr5 UTSW 17 25491224 missense probably benign
R5339:Sstr5 UTSW 17 25491199 missense probably benign 0.00
R5469:Sstr5 UTSW 17 25492069 missense probably damaging 1.00
R5865:Sstr5 UTSW 17 25491244 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- GCCTTCACCTTCACTACGATGAGC -3'
(R):5'- CCAGCAGTAGCCATAACTGGTCAC -3'

Sequencing Primer
(F):5'- TAAGTGATGAAGGCTGCACCC -3'
(R):5'- ACTTGTTGGTATGCACCGTG -3'
Posted On2013-05-09