Incidental Mutation 'R4735:Hydin'
ID356480
Institutional Source Beutler Lab
Gene Symbol Hydin
Ensembl Gene ENSMUSG00000059854
Gene NameHYDIN, axonemal central pair apparatus protein
Synonymshy-3, hyrh, hy3, 1700034M11Rik, 4930545D19Rik
MMRRC Submission 041962-MU
Accession Numbers

Ncbi RefSeq: NM_172916; MGI: 2389007

Is this an essential gene? Possibly essential (E-score: 0.675) question?
Stock #R4735 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location110266977-110610253 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 110555632 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000046204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043141] [ENSMUST00000043141]
Predicted Effect probably null
Transcript: ENSMUST00000043141
SMART Domains Protein: ENSMUSP00000046204
Gene: ENSMUSG00000059854

DomainStartEndE-ValueType
Pfam:Motile_Sperm 246 325 5.6e-8 PFAM
Pfam:ASH 559 659 9.4e-17 PFAM
low complexity region 788 798 N/A INTRINSIC
Pfam:PapD-like 848 906 1.2e-6 PFAM
low complexity region 998 1024 N/A INTRINSIC
low complexity region 1279 1292 N/A INTRINSIC
internal_repeat_6 1317 1549 5.96e-5 PROSPERO
internal_repeat_5 1355 1502 3.23e-5 PROSPERO
low complexity region 1574 1590 N/A INTRINSIC
internal_repeat_4 1712 1940 5.14e-6 PROSPERO
coiled coil region 1947 1977 N/A INTRINSIC
low complexity region 2009 2020 N/A INTRINSIC
low complexity region 2034 2049 N/A INTRINSIC
SCOP:d1eq1a_ 2305 2403 3e-4 SMART
low complexity region 2404 2419 N/A INTRINSIC
coiled coil region 2543 2588 N/A INTRINSIC
low complexity region 2636 2656 N/A INTRINSIC
internal_repeat_7 2772 3008 8.1e-5 PROSPERO
low complexity region 3660 3670 N/A INTRINSIC
low complexity region 3919 3934 N/A INTRINSIC
internal_repeat_5 4046 4190 3.23e-5 PROSPERO
internal_repeat_2 4106 4251 6.03e-7 PROSPERO
internal_repeat_4 4317 4532 5.14e-6 PROSPERO
internal_repeat_3 4403 4689 2.05e-6 PROSPERO
internal_repeat_2 4549 4697 6.03e-7 PROSPERO
low complexity region 4951 4964 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000043141
SMART Domains Protein: ENSMUSP00000046204
Gene: ENSMUSG00000059854

DomainStartEndE-ValueType
Pfam:Motile_Sperm 246 325 5.6e-8 PFAM
Pfam:ASH 559 659 9.4e-17 PFAM
low complexity region 788 798 N/A INTRINSIC
Pfam:PapD-like 848 906 1.2e-6 PFAM
low complexity region 998 1024 N/A INTRINSIC
low complexity region 1279 1292 N/A INTRINSIC
internal_repeat_6 1317 1549 5.96e-5 PROSPERO
internal_repeat_5 1355 1502 3.23e-5 PROSPERO
low complexity region 1574 1590 N/A INTRINSIC
internal_repeat_4 1712 1940 5.14e-6 PROSPERO
coiled coil region 1947 1977 N/A INTRINSIC
low complexity region 2009 2020 N/A INTRINSIC
low complexity region 2034 2049 N/A INTRINSIC
SCOP:d1eq1a_ 2305 2403 3e-4 SMART
low complexity region 2404 2419 N/A INTRINSIC
coiled coil region 2543 2588 N/A INTRINSIC
low complexity region 2636 2656 N/A INTRINSIC
internal_repeat_7 2772 3008 8.1e-5 PROSPERO
low complexity region 3660 3670 N/A INTRINSIC
low complexity region 3919 3934 N/A INTRINSIC
internal_repeat_5 4046 4190 3.23e-5 PROSPERO
internal_repeat_2 4106 4251 6.03e-7 PROSPERO
internal_repeat_4 4317 4532 5.14e-6 PROSPERO
internal_repeat_3 4403 4689 2.05e-6 PROSPERO
internal_repeat_2 4549 4697 6.03e-7 PROSPERO
low complexity region 4951 4964 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104619
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype Strain: 1856913; 3801608
Lethality: D28-D42
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may be involved in cilia motility. Mutations in this gene cause of autosomal recessive primary ciliary dyskinesia-5, a disorder characterized by the accumulation of cerebrospinal fluid within the ventricles of the brain. A duplicate copy of this gene has been found in humans on chromosome 1. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a mutation in this gene develop hydrocephaly after birth. Symptoms develop after 3-5 days. Affected animals usually die before 2 months of age. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(1) Gene trapped(3) Transgenic(1) Spontaneous(2)

Other mutations in this stock
Total: 133 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T A 12: 71,216,123 I1410N possibly damaging Het
4932411N23Rik T A X: 126,814,594 K296M probably damaging Het
4932438A13Rik T A 3: 37,004,967 N3267K possibly damaging Het
9230106D20Rik T C 10: 19,660,253 noncoding transcript Het
Acsf3 T A 8: 122,781,479 I238N probably damaging Het
Ahctf1 T C 1: 179,753,399 N1746S probably benign Het
Akap3 T C 6: 126,865,638 S407P probably damaging Het
Ankfy1 T A 11: 72,730,611 M241K probably benign Het
Ano7 C A 1: 93,400,494 T622K probably benign Het
App T C 16: 85,103,314 T83A probably damaging Het
Arhgef28 T A 13: 97,899,729 E1674V probably damaging Het
Asb2 C A 12: 103,325,058 V489L probably benign Het
Atrn T C 2: 131,020,990 V1330A probably benign Het
Brca1 A G 11: 101,492,175 probably null Het
Bspry G A 4: 62,486,525 R186Q probably damaging Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Celsr1 T A 15: 85,906,029 probably null Het
Ckap4 A G 10: 84,533,520 V116A possibly damaging Het
Crb3 A G 17: 57,065,207 T85A probably damaging Het
Cyld T C 8: 88,729,650 S443P probably damaging Het
Cyp27a1 T G 1: 74,737,207 V434G possibly damaging Het
Cyp2b13 A G 7: 26,088,295 T339A probably benign Het
Dars A T 1: 128,376,234 L252* probably null Het
Dcaf10 G A 4: 45,372,769 R394Q possibly damaging Het
Ddx55 T C 5: 124,566,476 F382S probably damaging Het
Dnah7b G A 1: 46,066,955 R33Q unknown Het
Dnm2 G T 9: 21,474,587 S302I probably damaging Het
Dock4 T A 12: 40,631,526 F75I probably benign Het
Dpp10 T C 1: 123,398,627 N365S probably benign Het
Dpy19l3 G T 7: 35,722,721 Q236K probably benign Het
Dsp T C 13: 38,196,040 S1655P probably damaging Het
Ebpl A T 14: 61,342,118 I117N probably damaging Het
Edc4 T A 8: 105,887,186 V386E probably damaging Het
Eif2s2 T A 2: 154,878,547 probably null Het
Elob A T 17: 23,827,588 probably null Het
Enox2 T C X: 49,069,677 I71V probably damaging Het
Fam160b1 A G 19: 57,371,229 E67G probably damaging Het
Fez1 A T 9: 36,860,845 K149* probably null Het
Fign A G 2: 63,980,438 Y163H probably damaging Het
Flnc G A 6: 29,455,813 G2048S probably damaging Het
Fras1 A G 5: 96,588,163 D539G probably benign Het
Frmd4b T C 6: 97,459,259 probably benign Het
Gan C T 8: 117,194,231 T402M probably damaging Het
Ganc T A 2: 120,436,623 silent Het
Ggt6 C A 11: 72,436,599 R103S probably benign Het
Gli2 T C 1: 118,840,322 D725G probably damaging Het
Gm15446 T A 5: 109,942,952 C357S probably damaging Het
Gm44501 A G 17: 40,578,919 N108S probably benign Het
Gm6309 A T 5: 146,168,244 D286E probably damaging Het
Gm6358 G A 16: 89,140,960 G29E unknown Het
Gm8251 A G 1: 44,061,701 I79T probably benign Het
Grik5 A G 7: 25,058,288 I422T probably damaging Het
Grin2c A G 11: 115,249,596 I1232T possibly damaging Het
Gsg1 C T 6: 135,237,407 R365H possibly damaging Het
H2-M2 A G 17: 37,483,244 S30P possibly damaging Het
Hcfc2 A G 10: 82,712,080 D302G probably damaging Het
Hk2 T C 6: 82,744,974 D128G probably benign Het
Hmcn2 C A 2: 31,383,775 Q1380K probably benign Het
Hsp90b1 G T 10: 86,693,955 P617T probably damaging Het
Htr1d A G 4: 136,442,886 E142G probably benign Het
Il1r1 T A 1: 40,293,295 N81K probably benign Het
Inpp5b T C 4: 124,783,967 S407P probably damaging Het
Itpkb T C 1: 180,418,215 Y766H probably damaging Het
Lyrm2 T A 4: 32,801,150 I65N probably damaging Het
Mink1 T A 11: 70,609,260 probably null Het
Mkrn3 C T 7: 62,419,704 R113H probably damaging Het
Msx3 G A 7: 140,047,885 A157V probably damaging Het
Nrxn2 T G 19: 6,498,454 V59G possibly damaging Het
Nt5c3b T C 11: 100,440,906 T12A probably benign Het
Nwd2 G A 5: 63,808,251 R1726Q probably benign Het
Nynrin A G 14: 55,870,168 T911A probably benign Het
Olfr1179 T C 2: 88,402,923 T4A probably benign Het
Olfr266 T A 3: 106,821,680 Y293F probably damaging Het
Olfr490 A G 7: 108,286,313 M271T probably benign Het
Olfr609 C T 7: 103,492,060 V273M possibly damaging Het
Olfr611 A G 7: 103,517,823 I187T possibly damaging Het
Olfr659 C T 7: 104,670,993 T97I probably benign Het
Olfr805 A G 10: 129,722,923 I207T probably benign Het
Patl1 G T 19: 11,922,505 M220I probably benign Het
Pcnx2 A T 8: 125,828,041 probably null Het
Pigr A T 1: 130,846,554 T424S probably damaging Het
Pik3c2b T A 1: 133,067,049 D250E probably benign Het
Ppa2 G A 3: 133,370,425 E272K probably benign Het
Pramel7 G A 2: 87,490,843 Q283* probably null Het
Prelid3b A G 2: 174,465,890 I81T probably benign Het
Prpf38a T C 4: 108,579,045 I24V possibly damaging Het
Ptger2 A G 14: 45,001,838 D311G possibly damaging Het
Rab4b A T 7: 27,172,766 probably benign Het
Rad17 A C 13: 100,619,129 D581E probably damaging Het
Samd11 T C 4: 156,248,773 T333A probably benign Het
Scaf4 C T 16: 90,252,432 D256N unknown Het
Serinc2 A G 4: 130,263,645 F82L probably benign Het
Serpina3g T A 12: 104,239,113 V37E probably damaging Het
Serpinb9c T A 13: 33,150,271 M263L probably benign Het
Shbg A G 11: 69,617,500 I67T possibly damaging Het
Slc25a48 G A 13: 56,449,074 probably null Het
Slc25a54 T C 3: 109,098,607 W144R probably damaging Het
Slc34a1 A T 13: 55,413,584 T621S probably benign Het
Slc6a18 A T 13: 73,666,435 C419S probably benign Het
Smc5 A T 19: 23,242,705 D389E probably benign Het
Smco3 T A 6: 136,831,638 E79D probably damaging Het
Sox5 A G 6: 143,960,835 F298S probably damaging Het
Sphkap A G 1: 83,279,117 S304P probably benign Het
Tcea2 C T 2: 181,686,721 T211I probably damaging Het
Tcf4 G T 18: 69,564,155 S34I possibly damaging Het
Tlr4 C T 4: 66,841,198 R743C probably damaging Het
Tmem183a T C 1: 134,360,882 E67G probably damaging Het
Tpr C T 1: 150,442,196 R2152C possibly damaging Het
Trbv15 T C 6: 41,141,424 I38T probably benign Het
Treh G A 9: 44,681,552 A125T probably damaging Het
Trio A T 15: 27,752,789 probably null Het
Ttn A G 2: 76,951,949 V981A probably damaging Het
Uap1l1 A G 2: 25,362,720 L436P probably damaging Het
Uba7 A T 9: 107,976,916 I182F possibly damaging Het
Unc13c A T 9: 73,693,338 S1375T probably benign Het
Usp48 C CT 4: 137,633,369 probably null Het
Utp20 A C 10: 88,816,918 V378G possibly damaging Het
Vmn1r69 A T 7: 10,580,999 probably benign Het
Vmn1r86 A T 7: 13,102,294 H218Q probably damaging Het
Vmn2r121 T A X: 124,128,638 I562L probably benign Het
Vmn2r45 A T 7: 8,483,473 I272N probably damaging Het
Wdr90 A G 17: 25,859,450 V320A probably benign Het
Wfikkn1 A G 17: 25,878,393 V319A possibly damaging Het
Whamm A G 7: 81,571,374 D18G probably benign Het
Wrn T A 8: 33,285,222 I605F probably damaging Het
Zdhhc18 A G 4: 133,613,867 F232L probably damaging Het
Zfp41 T C 15: 75,618,760 I187T probably benign Het
Zfp418 A G 7: 7,182,562 Y508C probably damaging Het
Zfp560 T G 9: 20,349,051 I172L probably benign Het
Zfp943 A T 17: 21,992,410 D159V probably benign Het
Zfp955a T C 17: 33,241,722 I479V probably benign Het
Zfpm1 T A 8: 122,335,480 V426D probably benign Het
Zic1 C T 9: 91,364,505 M171I possibly damaging Het
Other mutations in Hydin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Hydin APN 8 110569802 missense possibly damaging 0.69
IGL00432:Hydin APN 8 110601252 missense probably damaging 0.98
IGL01025:Hydin APN 8 110326401 missense probably benign 0.38
IGL01140:Hydin APN 8 110398062 missense probably benign 0.14
IGL01317:Hydin APN 8 110326446 missense probably damaging 0.98
IGL01473:Hydin APN 8 110312160 missense probably benign 0.08
IGL01473:Hydin APN 8 110354953 missense probably damaging 1.00
IGL01610:Hydin APN 8 110557713 missense probably benign 0.00
IGL01685:Hydin APN 8 110355033 nonsense probably null
IGL01734:Hydin APN 8 110490789 nonsense probably null
IGL01743:Hydin APN 8 110592776 missense possibly damaging 0.94
IGL01829:Hydin APN 8 110589522 missense possibly damaging 0.68
IGL01919:Hydin APN 8 110519174 missense possibly damaging 0.89
IGL01946:Hydin APN 8 110490718 missense possibly damaging 0.91
IGL01983:Hydin APN 8 110514895 missense probably benign 0.02
IGL02122:Hydin APN 8 110494415 missense possibly damaging 0.86
IGL02140:Hydin APN 8 110566938 missense probably benign
IGL02158:Hydin APN 8 110609966 missense possibly damaging 0.89
IGL02167:Hydin APN 8 110418423 missense possibly damaging 0.96
IGL02171:Hydin APN 8 110451958 nonsense probably null
IGL02185:Hydin APN 8 110506476 missense possibly damaging 0.86
IGL02517:Hydin APN 8 110566972 missense probably benign 0.01
IGL02639:Hydin APN 8 110538449 missense probably benign 0.01
IGL02644:Hydin APN 8 110538468 missense probably damaging 1.00
IGL02652:Hydin APN 8 110589522 missense possibly damaging 0.68
IGL02658:Hydin APN 8 110413276 missense possibly damaging 0.86
IGL02706:Hydin APN 8 110410566 missense probably damaging 0.99
IGL02892:Hydin APN 8 110598959 missense possibly damaging 0.89
IGL02947:Hydin APN 8 110418462 missense probably damaging 0.96
IGL03136:Hydin APN 8 110418524 missense probably benign 0.22
IGL03248:Hydin APN 8 110595289 missense probably damaging 0.97
IGL03251:Hydin APN 8 110490596 missense probably damaging 1.00
IGL03350:Hydin APN 8 110312224 missense possibly damaging 0.86
IGL03366:Hydin APN 8 110267363 missense unknown
IGL03404:Hydin APN 8 110569777 missense probably benign 0.06
Franz_joseph UTSW 8 110601318 missense probably damaging 1.00
maria UTSW 8 110509127 splice site probably benign
teresa UTSW 8 110609671 missense possibly damaging 0.79
P0005:Hydin UTSW 8 110494289 critical splice acceptor site probably null
R0099:Hydin UTSW 8 110589561 missense probably damaging 1.00
R0125:Hydin UTSW 8 110462531 missense probably benign 0.12
R0157:Hydin UTSW 8 110300010 missense possibly damaging 0.86
R0241:Hydin UTSW 8 110398023 missense probably benign 0.04
R0241:Hydin UTSW 8 110398023 missense probably benign 0.04
R0255:Hydin UTSW 8 110565018 missense probably benign 0.00
R0352:Hydin UTSW 8 110569901 critical splice donor site probably null
R0379:Hydin UTSW 8 110509127 splice site probably benign
R0468:Hydin UTSW 8 110413223 missense possibly damaging 0.96
R0477:Hydin UTSW 8 110418498 missense probably damaging 1.00
R0479:Hydin UTSW 8 110599088 missense probably damaging 1.00
R0539:Hydin UTSW 8 110523072 missense probably benign
R0550:Hydin UTSW 8 110587775 missense probably benign 0.01
R0571:Hydin UTSW 8 110514103 splice site probably null
R0606:Hydin UTSW 8 110549798 splice site probably benign
R0789:Hydin UTSW 8 110566971 missense possibly damaging 0.53
R0849:Hydin UTSW 8 110598984 missense probably damaging 1.00
R0946:Hydin UTSW 8 110531053 missense probably benign 0.25
R1201:Hydin UTSW 8 110569855 missense probably benign 0.01
R1375:Hydin UTSW 8 110506222 critical splice donor site probably null
R1385:Hydin UTSW 8 110523204 missense probably benign 0.40
R1411:Hydin UTSW 8 110575031 missense probably benign 0.04
R1437:Hydin UTSW 8 110581985 nonsense probably null
R1447:Hydin UTSW 8 110523166 missense probably damaging 1.00
R1448:Hydin UTSW 8 110446585 missense probably benign 0.27
R1466:Hydin UTSW 8 110532953 missense possibly damaging 0.47
R1466:Hydin UTSW 8 110532953 missense possibly damaging 0.47
R1523:Hydin UTSW 8 110533271 missense probably benign 0.05
R1544:Hydin UTSW 8 110574854 missense probably benign 0.30
R1581:Hydin UTSW 8 110410460 missense probably benign
R1584:Hydin UTSW 8 110580815 missense probably benign 0.27
R1598:Hydin UTSW 8 110410674 missense possibly damaging 0.96
R1633:Hydin UTSW 8 110506982 missense probably benign 0.10
R1777:Hydin UTSW 8 110589571 missense probably benign 0.14
R1817:Hydin UTSW 8 110532827 missense probably benign 0.00
R1828:Hydin UTSW 8 110510894 missense probably benign 0.03
R1837:Hydin UTSW 8 110569625 missense probably benign 0.20
R1848:Hydin UTSW 8 110569808 missense probably benign 0.19
R1869:Hydin UTSW 8 110500705 missense possibly damaging 0.94
R1909:Hydin UTSW 8 110587772 missense probably damaging 1.00
R1928:Hydin UTSW 8 110502947 missense possibly damaging 0.93
R1950:Hydin UTSW 8 110609987 missense possibly damaging 0.64
R2095:Hydin UTSW 8 110462657 missense probably damaging 0.96
R2172:Hydin UTSW 8 110582049 missense probably benign 0.42
R2217:Hydin UTSW 8 110418506 missense probably benign
R2248:Hydin UTSW 8 110578203 missense probably benign 0.09
R2272:Hydin UTSW 8 110309132 missense probably benign 0.01
R2294:Hydin UTSW 8 110299959 missense probably damaging 0.99
R2315:Hydin UTSW 8 110398044 missense probably benign 0.01
R2330:Hydin UTSW 8 110565009 missense probably benign 0.01
R2374:Hydin UTSW 8 110565148 missense probably damaging 1.00
R2446:Hydin UTSW 8 110587715 missense possibly damaging 0.82
R2484:Hydin UTSW 8 110513115 missense possibly damaging 0.76
R2698:Hydin UTSW 8 110609929 missense possibly damaging 0.70
R2843:Hydin UTSW 8 110519114 missense probably benign
R2844:Hydin UTSW 8 110519114 missense probably benign
R2846:Hydin UTSW 8 110519114 missense probably benign
R2882:Hydin UTSW 8 110566923 missense possibly damaging 0.92
R2937:Hydin UTSW 8 110404295 missense possibly damaging 0.88
R3031:Hydin UTSW 8 110603216 missense possibly damaging 0.83
R3038:Hydin UTSW 8 110582689 missense probably damaging 1.00
R3121:Hydin UTSW 8 110506506 missense probably benign
R3157:Hydin UTSW 8 110267373 missense unknown
R3547:Hydin UTSW 8 110582067 missense possibly damaging 0.85
R3696:Hydin UTSW 8 110603279 missense probably damaging 1.00
R3850:Hydin UTSW 8 110563929 missense probably damaging 0.99
R3896:Hydin UTSW 8 110509079 missense possibly damaging 0.93
R3983:Hydin UTSW 8 110392325 missense probably damaging 1.00
R4031:Hydin UTSW 8 110610047 missense probably benign 0.30
R4072:Hydin UTSW 8 110505256 missense possibly damaging 0.68
R4095:Hydin UTSW 8 110541547 missense probably damaging 0.98
R4176:Hydin UTSW 8 110593820 missense probably benign 0.00
R4213:Hydin UTSW 8 110456507 missense possibly damaging 0.91
R4412:Hydin UTSW 8 110415736 missense probably damaging 0.99
R4471:Hydin UTSW 8 110587132 missense probably damaging 1.00
R4474:Hydin UTSW 8 110563865 missense probably benign 0.11
R4495:Hydin UTSW 8 110595402 missense probably damaging 0.99
R4508:Hydin UTSW 8 110519254 missense possibly damaging 0.91
R4578:Hydin UTSW 8 110267339 missense unknown
R4583:Hydin UTSW 8 110595225 missense probably benign 0.36
R4600:Hydin UTSW 8 110566950 missense probably benign 0.04
R4681:Hydin UTSW 8 110506471 missense possibly damaging 0.85
R4685:Hydin UTSW 8 110462522 missense probably damaging 0.99
R4689:Hydin UTSW 8 110595414 missense probably benign 0.18
R4736:Hydin UTSW 8 110523208 missense probably benign 0.02
R4740:Hydin UTSW 8 110446439 missense probably benign 0.06
R4771:Hydin UTSW 8 110532883 missense probably benign
R4777:Hydin UTSW 8 110410464 missense probably damaging 0.98
R4859:Hydin UTSW 8 110506494 missense possibly damaging 0.93
R4911:Hydin UTSW 8 110595438 missense probably benign 0.01
R4964:Hydin UTSW 8 110490673 missense possibly damaging 0.86
R4965:Hydin UTSW 8 110398095 missense probably benign
R4989:Hydin UTSW 8 110563922 missense possibly damaging 0.84
R4995:Hydin UTSW 8 110569642 missense probably damaging 0.97
R5059:Hydin UTSW 8 110505769 missense probably damaging 0.96
R5071:Hydin UTSW 8 110538473 missense probably benign 0.03
R5073:Hydin UTSW 8 110538473 missense probably benign 0.03
R5092:Hydin UTSW 8 110582668 missense probably benign 0.16
R5156:Hydin UTSW 8 110609701 missense probably benign 0.00
R5166:Hydin UTSW 8 110523142 missense possibly damaging 0.89
R5189:Hydin UTSW 8 110413211 critical splice acceptor site probably null
R5243:Hydin UTSW 8 110505748 missense possibly damaging 0.92
R5244:Hydin UTSW 8 110532819 missense possibly damaging 0.77
R5256:Hydin UTSW 8 110587223 missense possibly damaging 0.92
R5266:Hydin UTSW 8 110334784 missense possibly damaging 0.87
R5283:Hydin UTSW 8 110451980 missense possibly damaging 0.96
R5343:Hydin UTSW 8 110485419 missense probably benign 0.40
R5359:Hydin UTSW 8 110538372 missense probably benign 0.00
R5390:Hydin UTSW 8 110595467 missense probably benign
R5394:Hydin UTSW 8 110539842 splice site probably null
R5441:Hydin UTSW 8 110565109 missense possibly damaging 0.72
R5461:Hydin UTSW 8 110519231 missense probably damaging 0.96
R5662:Hydin UTSW 8 110580709 missense probably benign 0.02
R5695:Hydin UTSW 8 110535283 missense probably benign 0.35
R5732:Hydin UTSW 8 110452058 missense probably benign 0.03
R5774:Hydin UTSW 8 110571915 nonsense probably null
R5780:Hydin UTSW 8 110586080 missense probably damaging 1.00
R5787:Hydin UTSW 8 110326353 missense probably damaging 0.99
R5802:Hydin UTSW 8 110452060 missense possibly damaging 0.86
R5841:Hydin UTSW 8 110533214 missense possibly damaging 0.76
R5856:Hydin UTSW 8 110541842 missense probably damaging 0.99
R5893:Hydin UTSW 8 110490676 missense probably benign 0.12
R5963:Hydin UTSW 8 110494294 missense possibly damaging 0.93
R6008:Hydin UTSW 8 110599085 missense probably benign 0.02
R6019:Hydin UTSW 8 110566620 missense probably benign
R6038:Hydin UTSW 8 110599031 missense probably benign 0.16
R6038:Hydin UTSW 8 110599031 missense probably benign 0.16
R6133:Hydin UTSW 8 110601276 missense probably benign 0.00
R6135:Hydin UTSW 8 110462660 missense possibly damaging 0.85
R6157:Hydin UTSW 8 110528016 missense probably benign
R6209:Hydin UTSW 8 110593802 missense probably benign 0.05
R6238:Hydin UTSW 8 110392111 intron probably null
R6293:Hydin UTSW 8 110597911 missense possibly damaging 0.83
R6340:Hydin UTSW 8 110354942 splice site probably null
R6349:Hydin UTSW 8 110418459 nonsense probably null
R6357:Hydin UTSW 8 110541657 missense possibly damaging 0.86
R6385:Hydin UTSW 8 110312224 missense possibly damaging 0.86
R6396:Hydin UTSW 8 110506889 missense probably damaging 0.96
R6466:Hydin UTSW 8 110506968 missense possibly damaging 0.85
R6648:Hydin UTSW 8 110525667 intron probably null
R6671:Hydin UTSW 8 110601318 missense probably damaging 1.00
R6695:Hydin UTSW 8 110326460 missense probably benign 0.05
R6800:Hydin UTSW 8 110597971 missense probably benign 0.09
R6841:Hydin UTSW 8 110538375 missense probably benign 0.09
R6867:Hydin UTSW 8 110539802 missense probably benign 0.08
R6889:Hydin UTSW 8 110532856 missense possibly damaging 0.79
R6895:Hydin UTSW 8 110312251 missense probably benign 0.00
R6940:Hydin UTSW 8 110490611 missense probably damaging 1.00
R6951:Hydin UTSW 8 110398125 missense probably benign
R6980:Hydin UTSW 8 110413284 missense possibly damaging 0.91
R6981:Hydin UTSW 8 110531072 missense possibly damaging 0.89
R7061:Hydin UTSW 8 110603288 missense possibly damaging 0.90
R7085:Hydin UTSW 8 110603330 missense probably benign 0.03
R7086:Hydin UTSW 8 110600245 missense possibly damaging 0.68
R7110:Hydin UTSW 8 110354951 critical splice acceptor site probably null
R7158:Hydin UTSW 8 110609671 missense possibly damaging 0.79
R7163:Hydin UTSW 8 110603336 missense probably benign 0.25
R7209:Hydin UTSW 8 110489792 nonsense probably null
R7244:Hydin UTSW 8 110549675 missense probably damaging 0.98
R7347:Hydin UTSW 8 110600362 missense probably benign 0.06
R7349:Hydin UTSW 8 110398171 splice site probably null
R7359:Hydin UTSW 8 110506101 missense probably damaging 0.98
R7365:Hydin UTSW 8 110557662 missense probably damaging 0.99
R7365:Hydin UTSW 8 110601273 missense probably damaging 1.00
R7436:Hydin UTSW 8 110583914 missense probably damaging 0.96
R7528:Hydin UTSW 8 110380572 nonsense probably null
R7544:Hydin UTSW 8 110589525 missense probably benign 0.35
R7625:Hydin UTSW 8 110541844 missense probably benign 0.01
R7713:Hydin UTSW 8 110593812 missense possibly damaging 0.69
X0063:Hydin UTSW 8 110551319 missense probably damaging 1.00
Z1088:Hydin UTSW 8 110299973 missense probably benign 0.12
Z1088:Hydin UTSW 8 110586048 missense probably benign 0.00
Z1088:Hydin UTSW 8 110592791 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CTTGTAATCTATAGAGGGGAGCCAG -3'
(R):5'- TAGAAGAGCCTGACCATTAAGC -3'

Sequencing Primer
(F):5'- CTATAGAGGGGAGCCAGTGCAAG -3'
(R):5'- AGCTATGTACATGTGTGTCTTTCATC -3'
Posted On2015-11-11