Mutagenetix > Incidental Mutation

Incidental Mutation 'R4735:Brca1'

356505

Institutional Source

Beutler Lab

Gene Symbol

Brca1

Ensembl Gene

ENSMUSG00000017146

Gene Name

breast cancer 1, early onset

Synonyms

MMRRC Submission

041962-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4735 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

101488764-101551955 bp(-) (GRCm38)

Type of Mutation

splice site (6 bp from exon)

DNA Base Change (assembly)

A to G at 101492175 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000017290 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017290]

AlphaFold

P48754

Predicted Effect

probably null
Transcript: ENSMUST00000017290

SMART Domains

Protein: ENSMUSP00000017290
Gene: ENSMUSG00000017146

Domain	Start	End	E-Value	Type
RING	24	64	1.82e-7	SMART
Pfam:BRCT_assoc	342	503	2.6e-69	PFAM
low complexity region	1173	1185	N/A	INTRINSIC
Blast:BRCT	1343	1406	2e-16	BLAST
low complexity region	1555	1575	N/A	INTRINSIC
BRCT	1587	1669	3.87e-11	SMART
BRCT	1700	1787	3.42e-12	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156843

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous null mutants are embryonic lethal with abnormalities including growth retardation, neural tube defects, and mesoderm abnormalities; conditional mutations cause genetic instability and enhanced tumor formation; mutants with truncated BRCA1 protein survive, have a kinky tail, pigmentation anomalies, male infertility and increased tumor incidence. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 133 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	T	A	12: 71,216,123	I1410N	possibly damaging	Het
4932411N23Rik	T	A	X: 126,814,594	K296M	probably damaging	Het
4932438A13Rik	T	A	3: 37,004,967	N3267K	possibly damaging	Het
9230106D20Rik	T	C	10: 19,660,253		noncoding transcript	Het
Acsf3	T	A	8: 122,781,479	I238N	probably damaging	Het
Ahctf1	T	C	1: 179,753,399	N1746S	probably benign	Het
Akap3	T	C	6: 126,865,638	S407P	probably damaging	Het
Ankfy1	T	A	11: 72,730,611	M241K	probably benign	Het
Ano7	C	A	1: 93,400,494	T622K	probably benign	Het
App	T	C	16: 85,103,314	T83A	probably damaging	Het
Arhgef28	T	A	13: 97,899,729	E1674V	probably damaging	Het
Asb2	C	A	12: 103,325,058	V489L	probably benign	Het
Atrn	T	C	2: 131,020,990	V1330A	probably benign	Het
Bspry	G	A	4: 62,486,525	R186Q	probably damaging	Het
Cdkn2d	C	G	9: 21,290,889	V21L	probably benign	Het
Celsr1	T	A	15: 85,906,029		probably null	Het
Ckap4	A	G	10: 84,533,520	V116A	possibly damaging	Het
Crb3	A	G	17: 57,065,207	T85A	probably damaging	Het
Cyld	T	C	8: 88,729,650	S443P	probably damaging	Het
Cyp27a1	T	G	1: 74,737,207	V434G	possibly damaging	Het
Cyp2b13	A	G	7: 26,088,295	T339A	probably benign	Het
Dars	A	T	1: 128,376,234	L252*	probably null	Het
Dcaf10	G	A	4: 45,372,769	R394Q	possibly damaging	Het
Ddx55	T	C	5: 124,566,476	F382S	probably damaging	Het
Dnah7b	G	A	1: 46,066,955	R33Q	unknown	Het
Dnm2	G	T	9: 21,474,587	S302I	probably damaging	Het
Dock4	T	A	12: 40,631,526	F75I	probably benign	Het
Dpp10	T	C	1: 123,398,627	N365S	probably benign	Het
Dpy19l3	G	T	7: 35,722,721	Q236K	probably benign	Het
Dsp	T	C	13: 38,196,040	S1655P	probably damaging	Het
Ebpl	A	T	14: 61,342,118	I117N	probably damaging	Het
Edc4	T	A	8: 105,887,186	V386E	probably damaging	Het
Eif2s2	T	A	2: 154,878,547		probably null	Het
Elob	A	T	17: 23,827,588		probably null	Het
Enox2	T	C	X: 49,069,677	I71V	probably damaging	Het
Fam160b1	A	G	19: 57,371,229	E67G	probably damaging	Het
Fez1	A	T	9: 36,860,845	K149*	probably null	Het
Fign	A	G	2: 63,980,438	Y163H	probably damaging	Het
Flnc	G	A	6: 29,455,813	G2048S	probably damaging	Het
Fras1	A	G	5: 96,588,163	D539G	probably benign	Het
Frmd4b	T	C	6: 97,459,259		probably benign	Het
Gan	C	T	8: 117,194,231	T402M	probably damaging	Het
Ganc	T	A	2: 120,436,623		silent	Het
Ggt6	C	A	11: 72,436,599	R103S	probably benign	Het
Gli2	T	C	1: 118,840,322	D725G	probably damaging	Het
Gm15446	T	A	5: 109,942,952	C357S	probably damaging	Het
Gm44501	A	G	17: 40,578,919	N108S	probably benign	Het
Gm6309	A	T	5: 146,168,244	D286E	probably damaging	Het
Gm6358	G	A	16: 89,140,960	G29E	unknown	Het
Gm8251	A	G	1: 44,061,701	I79T	probably benign	Het
Grik5	A	G	7: 25,058,288	I422T	probably damaging	Het
Grin2c	A	G	11: 115,249,596	I1232T	possibly damaging	Het
Gsg1	C	T	6: 135,237,407	R365H	possibly damaging	Het
H2-M2	A	G	17: 37,483,244	S30P	possibly damaging	Het
Hcfc2	A	G	10: 82,712,080	D302G	probably damaging	Het
Hk2	T	C	6: 82,744,974	D128G	probably benign	Het
Hmcn2	C	A	2: 31,383,775	Q1380K	probably benign	Het
Hsp90b1	G	T	10: 86,693,955	P617T	probably damaging	Het
Htr1d	A	G	4: 136,442,886	E142G	probably benign	Het
Hydin	G	A	8: 110,555,632		probably null	Het
Il1r1	T	A	1: 40,293,295	N81K	probably benign	Het
Inpp5b	T	C	4: 124,783,967	S407P	probably damaging	Het
Itpkb	T	C	1: 180,418,215	Y766H	probably damaging	Het
Lyrm2	T	A	4: 32,801,150	I65N	probably damaging	Het
Mink1	T	A	11: 70,609,260		probably null	Het
Mkrn3	C	T	7: 62,419,704	R113H	probably damaging	Het
Msx3	G	A	7: 140,047,885	A157V	probably damaging	Het
Nrxn2	T	G	19: 6,498,454	V59G	possibly damaging	Het
Nt5c3b	T	C	11: 100,440,906	T12A	probably benign	Het
Nwd2	G	A	5: 63,808,251	R1726Q	probably benign	Het
Nynrin	A	G	14: 55,870,168	T911A	probably benign	Het
Olfr1179	T	C	2: 88,402,923	T4A	probably benign	Het
Olfr266	T	A	3: 106,821,680	Y293F	probably damaging	Het
Olfr490	A	G	7: 108,286,313	M271T	probably benign	Het
Olfr609	C	T	7: 103,492,060	V273M	possibly damaging	Het
Olfr611	A	G	7: 103,517,823	I187T	possibly damaging	Het
Olfr659	C	T	7: 104,670,993	T97I	probably benign	Het
Olfr805	A	G	10: 129,722,923	I207T	probably benign	Het
Patl1	G	T	19: 11,922,505	M220I	probably benign	Het
Pcnx2	A	T	8: 125,828,041		probably null	Het
Pigr	A	T	1: 130,846,554	T424S	probably damaging	Het
Pik3c2b	T	A	1: 133,067,049	D250E	probably benign	Het
Ppa2	G	A	3: 133,370,425	E272K	probably benign	Het
Pramel7	G	A	2: 87,490,843	Q283*	probably null	Het
Prelid3b	A	G	2: 174,465,890	I81T	probably benign	Het
Prpf38a	T	C	4: 108,579,045	I24V	possibly damaging	Het
Ptger2	A	G	14: 45,001,838	D311G	possibly damaging	Het
Rab4b	A	T	7: 27,172,766		probably benign	Het
Rad17	A	C	13: 100,619,129	D581E	probably damaging	Het
Samd11	T	C	4: 156,248,773	T333A	probably benign	Het
Scaf4	C	T	16: 90,252,432	D256N	unknown	Het
Serinc2	A	G	4: 130,263,645	F82L	probably benign	Het
Serpina3g	T	A	12: 104,239,113	V37E	probably damaging	Het
Serpinb9c	T	A	13: 33,150,271	M263L	probably benign	Het
Shbg	A	G	11: 69,617,500	I67T	possibly damaging	Het
Slc25a48	G	A	13: 56,449,074		probably null	Het
Slc25a54	T	C	3: 109,098,607	W144R	probably damaging	Het
Slc34a1	A	T	13: 55,413,584	T621S	probably benign	Het
Slc6a18	A	T	13: 73,666,435	C419S	probably benign	Het
Smc5	A	T	19: 23,242,705	D389E	probably benign	Het
Smco3	T	A	6: 136,831,638	E79D	probably damaging	Het
Sox5	A	G	6: 143,960,835	F298S	probably damaging	Het
Sphkap	A	G	1: 83,279,117	S304P	probably benign	Het
Tcea2	C	T	2: 181,686,721	T211I	probably damaging	Het
Tcf4	G	T	18: 69,564,155	S34I	possibly damaging	Het
Tlr4	C	T	4: 66,841,198	R743C	probably damaging	Het
Tmem183a	T	C	1: 134,360,882	E67G	probably damaging	Het
Tpr	C	T	1: 150,442,196	R2152C	possibly damaging	Het
Trbv15	T	C	6: 41,141,424	I38T	probably benign	Het
Treh	G	A	9: 44,681,552	A125T	probably damaging	Het
Trio	A	T	15: 27,752,789		probably null	Het
Ttn	A	G	2: 76,951,949	V981A	probably damaging	Het
Uap1l1	A	G	2: 25,362,720	L436P	probably damaging	Het
Uba7	A	T	9: 107,976,916	I182F	possibly damaging	Het
Unc13c	A	T	9: 73,693,338	S1375T	probably benign	Het
Usp48	C	CT	4: 137,633,369		probably null	Het
Utp20	A	C	10: 88,816,918	V378G	possibly damaging	Het
Vmn1r69	A	T	7: 10,580,999		probably benign	Het
Vmn1r86	A	T	7: 13,102,294	H218Q	probably damaging	Het
Vmn2r121	T	A	X: 124,128,638	I562L	probably benign	Het
Vmn2r45	A	T	7: 8,483,473	I272N	probably damaging	Het
Wdr90	A	G	17: 25,859,450	V320A	probably benign	Het
Wfikkn1	A	G	17: 25,878,393	V319A	possibly damaging	Het
Whamm	A	G	7: 81,571,374	D18G	probably benign	Het
Wrn	T	A	8: 33,285,222	I605F	probably damaging	Het
Zdhhc18	A	G	4: 133,613,867	F232L	probably damaging	Het
Zfp41	T	C	15: 75,618,760	I187T	probably benign	Het
Zfp418	A	G	7: 7,182,562	Y508C	probably damaging	Het
Zfp560	T	G	9: 20,349,051	I172L	probably benign	Het
Zfp943	A	T	17: 21,992,410	D159V	probably benign	Het
Zfp955a	T	C	17: 33,241,722	I479V	probably benign	Het
Zfpm1	T	A	8: 122,335,480	V426D	probably benign	Het
Zic1	C	T	9: 91,364,505	M171I	possibly damaging	Het

Other mutations in Brca1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01095:Brca1	APN	11	101524369	missense	possibly damaging	0.71
IGL01598:Brca1	APN	11	101524330	missense	probably benign	0.04
IGL01744:Brca1	APN	11	101524176	missense	possibly damaging	0.73
IGL02128:Brca1	APN	11	101530982	unclassified	probably benign
IGL02377:Brca1	APN	11	101524323	missense	probably benign	0.01
IGL02701:Brca1	APN	11	101525235	missense	probably damaging	1.00
IGL02732:Brca1	APN	11	101492219	missense	probably benign	0.07
IGL02935:Brca1	APN	11	101489867	missense	probably benign	0.00
IGL02940:Brca1	APN	11	101489912	missense	probably benign	0.00
IGL03198:Brca1	APN	11	101512711	splice site	probably benign
BB002:Brca1	UTSW	11	101508146	missense	probably benign	0.01
BB009:Brca1	UTSW	11	101540017	missense	possibly damaging	0.85
BB012:Brca1	UTSW	11	101508146	missense	probably benign	0.01
BB019:Brca1	UTSW	11	101540017	missense	possibly damaging	0.85
PIT4142001:Brca1	UTSW	11	101522422	unclassified	probably benign
R0048:Brca1	UTSW	11	101524977	missense	possibly damaging	0.94
R0048:Brca1	UTSW	11	101524977	missense	possibly damaging	0.94
R0109:Brca1	UTSW	11	101531090	missense	possibly damaging	0.85
R0109:Brca1	UTSW	11	101531090	missense	possibly damaging	0.85
R0144:Brca1	UTSW	11	101526121	missense	probably damaging	1.00
R0336:Brca1	UTSW	11	101523993	missense	probably benign	0.04
R0448:Brca1	UTSW	11	101508221	missense	possibly damaging	0.93
R0595:Brca1	UTSW	11	101524887	missense	probably benign	0.27
R0613:Brca1	UTSW	11	101508210	missense	probably benign	0.18
R0863:Brca1	UTSW	11	101524770	missense	probably benign	0.36
R0940:Brca1	UTSW	11	101532143	missense	possibly damaging	0.73
R0962:Brca1	UTSW	11	101525366	missense	possibly damaging	0.46
R1365:Brca1	UTSW	11	101501996	missense	probably benign
R1391:Brca1	UTSW	11	101526546	missense	possibly damaging	0.53
R1467:Brca1	UTSW	11	101531107	unclassified	probably benign
R1484:Brca1	UTSW	11	101529812	missense	possibly damaging	0.86
R1530:Brca1	UTSW	11	101524695	missense	probably damaging	1.00
R1645:Brca1	UTSW	11	101510053	missense	probably benign	0.00
R1682:Brca1	UTSW	11	101525565	missense	probably damaging	0.98
R1687:Brca1	UTSW	11	101489840	missense	probably benign
R1694:Brca1	UTSW	11	101532099	missense	probably damaging	0.98
R1695:Brca1	UTSW	11	101524455	missense	probably damaging	0.97
R1762:Brca1	UTSW	11	101532018	critical splice donor site	probably null
R1868:Brca1	UTSW	11	101498013	missense	probably benign
R1973:Brca1	UTSW	11	101526403	missense	probably benign	0.22
R2034:Brca1	UTSW	11	101489849	missense	probably benign
R2106:Brca1	UTSW	11	101524977	missense	possibly damaging	0.94
R4089:Brca1	UTSW	11	101524176	missense	possibly damaging	0.73
R4194:Brca1	UTSW	11	101525287	missense	probably benign	0.02
R4571:Brca1	UTSW	11	101517366	missense	probably benign	0.00
R4789:Brca1	UTSW	11	101523932	missense	probably benign	0.00
R4920:Brca1	UTSW	11	101524959	missense	probably damaging	1.00
R4939:Brca1	UTSW	11	101508050	missense	probably benign
R4997:Brca1	UTSW	11	101524333	missense	probably damaging	0.96
R5458:Brca1	UTSW	11	101517285	missense	possibly damaging	0.53
R5778:Brca1	UTSW	11	101525301	missense	possibly damaging	0.47
R6051:Brca1	UTSW	11	101524246	missense	probably damaging	1.00
R6505:Brca1	UTSW	11	101523541	missense	probably benign	0.03
R6548:Brca1	UTSW	11	101524765	missense	probably damaging	1.00
R6971:Brca1	UTSW	11	101534005	missense	probably benign	0.18
R7091:Brca1	UTSW	11	101526427	missense	probably benign	0.00
R7246:Brca1	UTSW	11	101523378	missense	probably benign	0.00
R7417:Brca1	UTSW	11	101524981	missense	probably damaging	1.00
R7861:Brca1	UTSW	11	101526422	missense	possibly damaging	0.87
R7925:Brca1	UTSW	11	101508146	missense	probably benign	0.01
R7932:Brca1	UTSW	11	101540017	missense	possibly damaging	0.85
R8003:Brca1	UTSW	11	101524477	missense	probably benign	0.22
R8046:Brca1	UTSW	11	101525470	missense	probably benign	0.03
R8306:Brca1	UTSW	11	101525637	missense	probably damaging	1.00
R8483:Brca1	UTSW	11	101525976	missense	probably damaging	0.99
R8685:Brca1	UTSW	11	101489846	missense	probably benign	0.19
R9072:Brca1	UTSW	11	101502480	critical splice donor site	probably null
R9073:Brca1	UTSW	11	101502480	critical splice donor site	probably null
R9486:Brca1	UTSW	11	101523694	missense	probably benign	0.00
R9505:Brca1	UTSW	11	101512766	missense	probably benign	0.00
R9616:Brca1	UTSW	11	101525857	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAAGGAAAAGACCTCCCTCG -3'
(R):5'- ACATCAGCGGCAGATTGAC -3'

Sequencing Primer
(F):5'- CCTCGATACATTCAATGCTTACAG -3'
(R):5'- CATCAGCGGCAGATTGACTTAGAAG -3'

Posted On

2015-11-11