Mutagenetix > Incidental Mutation

Incidental Mutation 'R4735:Dsp'

356512

Institutional Source

Beutler Lab

Gene Symbol

Dsp

Ensembl Gene

ENSMUSG00000054889

Gene Name

desmoplakin

Synonyms

5730453H04Rik, DP, 2300002E22Rik

MMRRC Submission

041962-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4735 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

38151294-38198577 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 38196040 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1655 (S1655P)

Ref Sequence

ENSEMBL: ENSMUSP00000117252 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000124830] [ENSMUST00000127906]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000124830
AA Change: S2254P

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000115062
Gene: ENSMUSG00000054889
AA Change: S2254P

Domain	Start	End	E-Value	Type
Blast:SPEC	193	282	2e-51	BLAST
SPEC	285	385	6.03e-2	SMART
Blast:SPEC	391	557	1e-96	BLAST
Blast:SPEC	783	894	4e-34	BLAST
SPEC	901	1030	1.39e0	SMART
coiled coil region	1033	1370	N/A	INTRINSIC
coiled coil region	1394	1956	N/A	INTRINSIC
low complexity region	1997	2011	N/A	INTRINSIC
PLEC	2021	2057	3.33e-1	SMART
PLEC	2058	2095	3.76e-9	SMART
PLEC	2096	2133	4.09e-10	SMART
PLEC	2134	2171	2.09e-7	SMART
PLEC	2175	2209	4.83e1	SMART
PLEC	2210	2245	5.67e1	SMART
PLEC	2263	2300	1.22e-8	SMART
PLEC	2301	2338	1.16e-9	SMART
PLEC	2339	2376	1.12e-7	SMART
PLEC	2377	2414	1.56e-6	SMART
PLEC	2418	2452	1.42e0	SMART
PLEC	2468	2505	3.7e-8	SMART
low complexity region	2507	2517	N/A	INTRINSIC
PLEC	2519	2556	3.73e-4	SMART
low complexity region	2577	2593	N/A	INTRINSIC
PLEC	2622	2659	1.46e-6	SMART
PLEC	2660	2697	6.69e-15	SMART
PLEC	2698	2735	1.98e2	SMART
PLEC	2736	2773	2.35e-10	SMART
PLEC	2774	2811	1.39e-3	SMART
low complexity region	2835	2860	N/A	INTRINSIC
low complexity region	2867	2879	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000127906
AA Change: S1655P

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000117252
Gene: ENSMUSG00000054889
AA Change: S1655P

Domain	Start	End	E-Value	Type
Blast:SPEC	193	282	2e-51	BLAST
SPEC	285	385	6.03e-2	SMART
Blast:SPEC	391	557	1e-95	BLAST
Blast:SPEC	783	894	3e-34	BLAST
SPEC	901	1030	1.39e0	SMART
coiled coil region	1033	1357	N/A	INTRINSIC
low complexity region	1398	1412	N/A	INTRINSIC
PLEC	1422	1458	3.33e-1	SMART
PLEC	1459	1496	3.76e-9	SMART
PLEC	1497	1534	4.09e-10	SMART
PLEC	1535	1572	2.09e-7	SMART
PLEC	1576	1610	4.83e1	SMART
PLEC	1611	1646	5.67e1	SMART
PLEC	1664	1701	1.22e-8	SMART
PLEC	1702	1739	1.16e-9	SMART
PLEC	1740	1777	1.12e-7	SMART
PLEC	1778	1815	1.56e-6	SMART
PLEC	1819	1853	1.42e0	SMART
PLEC	1869	1906	3.7e-8	SMART
low complexity region	1908	1918	N/A	INTRINSIC
PLEC	1920	1957	3.73e-4	SMART
low complexity region	1978	1994	N/A	INTRINSIC
PLEC	2023	2060	1.46e-6	SMART
PLEC	2061	2098	6.69e-15	SMART
PLEC	2099	2136	1.98e2	SMART
PLEC	2137	2174	2.35e-10	SMART
PLEC	2175	2212	1.39e-3	SMART
low complexity region	2236	2261	N/A	INTRINSIC
low complexity region	2268	2280	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that anchors intermediate filaments to desmosomal plaques and forms an obligate component of functional desmosomes. Mutations in this gene are the cause of several cardiomyopathies and keratodermas, including skin fragility-woolly hair syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous targeted null mutants die by embryonic day E6.5 due to instability of desmosomes and tissue integrity; rescue by aggregation with wild-type tetraploid morulae increase embyronic survival with noted major defects in heart muscle, neuroepithelium and epidermis; conditional knockouts that are epidermal-specific have compositionally altered epidermal desmosomes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 133 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	T	A	12: 71,216,123	I1410N	possibly damaging	Het
4932411N23Rik	T	A	X: 126,814,594	K296M	probably damaging	Het
4932438A13Rik	T	A	3: 37,004,967	N3267K	possibly damaging	Het
9230106D20Rik	T	C	10: 19,660,253		noncoding transcript	Het
Acsf3	T	A	8: 122,781,479	I238N	probably damaging	Het
Ahctf1	T	C	1: 179,753,399	N1746S	probably benign	Het
Akap3	T	C	6: 126,865,638	S407P	probably damaging	Het
Ankfy1	T	A	11: 72,730,611	M241K	probably benign	Het
Ano7	C	A	1: 93,400,494	T622K	probably benign	Het
App	T	C	16: 85,103,314	T83A	probably damaging	Het
Arhgef28	T	A	13: 97,899,729	E1674V	probably damaging	Het
Asb2	C	A	12: 103,325,058	V489L	probably benign	Het
Atrn	T	C	2: 131,020,990	V1330A	probably benign	Het
Brca1	A	G	11: 101,492,175		probably null	Het
Bspry	G	A	4: 62,486,525	R186Q	probably damaging	Het
Cdkn2d	C	G	9: 21,290,889	V21L	probably benign	Het
Celsr1	T	A	15: 85,906,029		probably null	Het
Ckap4	A	G	10: 84,533,520	V116A	possibly damaging	Het
Crb3	A	G	17: 57,065,207	T85A	probably damaging	Het
Cyld	T	C	8: 88,729,650	S443P	probably damaging	Het
Cyp27a1	T	G	1: 74,737,207	V434G	possibly damaging	Het
Cyp2b13	A	G	7: 26,088,295	T339A	probably benign	Het
Dars	A	T	1: 128,376,234	L252*	probably null	Het
Dcaf10	G	A	4: 45,372,769	R394Q	possibly damaging	Het
Ddx55	T	C	5: 124,566,476	F382S	probably damaging	Het
Dnah7b	G	A	1: 46,066,955	R33Q	unknown	Het
Dnm2	G	T	9: 21,474,587	S302I	probably damaging	Het
Dock4	T	A	12: 40,631,526	F75I	probably benign	Het
Dpp10	T	C	1: 123,398,627	N365S	probably benign	Het
Dpy19l3	G	T	7: 35,722,721	Q236K	probably benign	Het
Ebpl	A	T	14: 61,342,118	I117N	probably damaging	Het
Edc4	T	A	8: 105,887,186	V386E	probably damaging	Het
Eif2s2	T	A	2: 154,878,547		probably null	Het
Elob	A	T	17: 23,827,588		probably null	Het
Enox2	T	C	X: 49,069,677	I71V	probably damaging	Het
Fam160b1	A	G	19: 57,371,229	E67G	probably damaging	Het
Fez1	A	T	9: 36,860,845	K149*	probably null	Het
Fign	A	G	2: 63,980,438	Y163H	probably damaging	Het
Flnc	G	A	6: 29,455,813	G2048S	probably damaging	Het
Fras1	A	G	5: 96,588,163	D539G	probably benign	Het
Frmd4b	T	C	6: 97,459,259		probably benign	Het
Gan	C	T	8: 117,194,231	T402M	probably damaging	Het
Ganc	T	A	2: 120,436,623		silent	Het
Ggt6	C	A	11: 72,436,599	R103S	probably benign	Het
Gli2	T	C	1: 118,840,322	D725G	probably damaging	Het
Gm15446	T	A	5: 109,942,952	C357S	probably damaging	Het
Gm44501	A	G	17: 40,578,919	N108S	probably benign	Het
Gm6309	A	T	5: 146,168,244	D286E	probably damaging	Het
Gm6358	G	A	16: 89,140,960	G29E	unknown	Het
Gm8251	A	G	1: 44,061,701	I79T	probably benign	Het
Grik5	A	G	7: 25,058,288	I422T	probably damaging	Het
Grin2c	A	G	11: 115,249,596	I1232T	possibly damaging	Het
Gsg1	C	T	6: 135,237,407	R365H	possibly damaging	Het
H2-M2	A	G	17: 37,483,244	S30P	possibly damaging	Het
Hcfc2	A	G	10: 82,712,080	D302G	probably damaging	Het
Hk2	T	C	6: 82,744,974	D128G	probably benign	Het
Hmcn2	C	A	2: 31,383,775	Q1380K	probably benign	Het
Hsp90b1	G	T	10: 86,693,955	P617T	probably damaging	Het
Htr1d	A	G	4: 136,442,886	E142G	probably benign	Het
Hydin	G	A	8: 110,555,632		probably null	Het
Il1r1	T	A	1: 40,293,295	N81K	probably benign	Het
Inpp5b	T	C	4: 124,783,967	S407P	probably damaging	Het
Itpkb	T	C	1: 180,418,215	Y766H	probably damaging	Het
Lyrm2	T	A	4: 32,801,150	I65N	probably damaging	Het
Mink1	T	A	11: 70,609,260		probably null	Het
Mkrn3	C	T	7: 62,419,704	R113H	probably damaging	Het
Msx3	G	A	7: 140,047,885	A157V	probably damaging	Het
Nrxn2	T	G	19: 6,498,454	V59G	possibly damaging	Het
Nt5c3b	T	C	11: 100,440,906	T12A	probably benign	Het
Nwd2	G	A	5: 63,808,251	R1726Q	probably benign	Het
Nynrin	A	G	14: 55,870,168	T911A	probably benign	Het
Olfr1179	T	C	2: 88,402,923	T4A	probably benign	Het
Olfr266	T	A	3: 106,821,680	Y293F	probably damaging	Het
Olfr490	A	G	7: 108,286,313	M271T	probably benign	Het
Olfr609	C	T	7: 103,492,060	V273M	possibly damaging	Het
Olfr611	A	G	7: 103,517,823	I187T	possibly damaging	Het
Olfr659	C	T	7: 104,670,993	T97I	probably benign	Het
Olfr805	A	G	10: 129,722,923	I207T	probably benign	Het
Patl1	G	T	19: 11,922,505	M220I	probably benign	Het
Pcnx2	A	T	8: 125,828,041		probably null	Het
Pigr	A	T	1: 130,846,554	T424S	probably damaging	Het
Pik3c2b	T	A	1: 133,067,049	D250E	probably benign	Het
Ppa2	G	A	3: 133,370,425	E272K	probably benign	Het
Pramel7	G	A	2: 87,490,843	Q283*	probably null	Het
Prelid3b	A	G	2: 174,465,890	I81T	probably benign	Het
Prpf38a	T	C	4: 108,579,045	I24V	possibly damaging	Het
Ptger2	A	G	14: 45,001,838	D311G	possibly damaging	Het
Rab4b	A	T	7: 27,172,766		probably benign	Het
Rad17	A	C	13: 100,619,129	D581E	probably damaging	Het
Samd11	T	C	4: 156,248,773	T333A	probably benign	Het
Scaf4	C	T	16: 90,252,432	D256N	unknown	Het
Serinc2	A	G	4: 130,263,645	F82L	probably benign	Het
Serpina3g	T	A	12: 104,239,113	V37E	probably damaging	Het
Serpinb9c	T	A	13: 33,150,271	M263L	probably benign	Het
Shbg	A	G	11: 69,617,500	I67T	possibly damaging	Het
Slc25a48	G	A	13: 56,449,074		probably null	Het
Slc25a54	T	C	3: 109,098,607	W144R	probably damaging	Het
Slc34a1	A	T	13: 55,413,584	T621S	probably benign	Het
Slc6a18	A	T	13: 73,666,435	C419S	probably benign	Het
Smc5	A	T	19: 23,242,705	D389E	probably benign	Het
Smco3	T	A	6: 136,831,638	E79D	probably damaging	Het
Sox5	A	G	6: 143,960,835	F298S	probably damaging	Het
Sphkap	A	G	1: 83,279,117	S304P	probably benign	Het
Tcea2	C	T	2: 181,686,721	T211I	probably damaging	Het
Tcf4	G	T	18: 69,564,155	S34I	possibly damaging	Het
Tlr4	C	T	4: 66,841,198	R743C	probably damaging	Het
Tmem183a	T	C	1: 134,360,882	E67G	probably damaging	Het
Tpr	C	T	1: 150,442,196	R2152C	possibly damaging	Het
Trbv15	T	C	6: 41,141,424	I38T	probably benign	Het
Treh	G	A	9: 44,681,552	A125T	probably damaging	Het
Trio	A	T	15: 27,752,789		probably null	Het
Ttn	A	G	2: 76,951,949	V981A	probably damaging	Het
Uap1l1	A	G	2: 25,362,720	L436P	probably damaging	Het
Uba7	A	T	9: 107,976,916	I182F	possibly damaging	Het
Unc13c	A	T	9: 73,693,338	S1375T	probably benign	Het
Usp48	C	CT	4: 137,633,369		probably null	Het
Utp20	A	C	10: 88,816,918	V378G	possibly damaging	Het
Vmn1r69	A	T	7: 10,580,999		probably benign	Het
Vmn1r86	A	T	7: 13,102,294	H218Q	probably damaging	Het
Vmn2r121	T	A	X: 124,128,638	I562L	probably benign	Het
Vmn2r45	A	T	7: 8,483,473	I272N	probably damaging	Het
Wdr90	A	G	17: 25,859,450	V320A	probably benign	Het
Wfikkn1	A	G	17: 25,878,393	V319A	possibly damaging	Het
Whamm	A	G	7: 81,571,374	D18G	probably benign	Het
Wrn	T	A	8: 33,285,222	I605F	probably damaging	Het
Zdhhc18	A	G	4: 133,613,867	F232L	probably damaging	Het
Zfp41	T	C	15: 75,618,760	I187T	probably benign	Het
Zfp418	A	G	7: 7,182,562	Y508C	probably damaging	Het
Zfp560	T	G	9: 20,349,051	I172L	probably benign	Het
Zfp943	A	T	17: 21,992,410	D159V	probably benign	Het
Zfp955a	T	C	17: 33,241,722	I479V	probably benign	Het
Zfpm1	T	A	8: 122,335,480	V426D	probably benign	Het
Zic1	C	T	9: 91,364,505	M171I	possibly damaging	Het

Other mutations in Dsp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Dsp	APN	13	38197846	missense	probably damaging	0.99
IGL01337:Dsp	APN	13	38192687	missense	probably benign	0.44
IGL01371:Dsp	APN	13	38193617	missense	probably benign	0.13
IGL01473:Dsp	APN	13	38167571	missense	probably damaging	0.99
IGL01660:Dsp	APN	13	38176495	missense	possibly damaging	0.90
IGL01723:Dsp	APN	13	38179084	missense	probably damaging	1.00
IGL01999:Dsp	APN	13	38181186	missense	probably damaging	0.99
IGL02313:Dsp	APN	13	38196523	nonsense	probably null
IGL02833:Dsp	APN	13	38192921	missense	possibly damaging	0.56
IGL03050:Dsp	APN	13	38188445	splice site	probably benign
IGL03353:Dsp	APN	13	38186695	missense	probably damaging	1.00
R0052:Dsp	UTSW	13	38197364	missense	possibly damaging	0.93
R0052:Dsp	UTSW	13	38197364	missense	possibly damaging	0.93
R0078:Dsp	UTSW	13	38196017	missense	probably benign	0.22
R0230:Dsp	UTSW	13	38197705	missense	probably benign	0.03
R0234:Dsp	UTSW	13	38187893	missense	probably benign	0.13
R0234:Dsp	UTSW	13	38187893	missense	probably benign	0.13
R0285:Dsp	UTSW	13	38172794	missense	probably benign
R0326:Dsp	UTSW	13	38192870	nonsense	probably null
R0332:Dsp	UTSW	13	38182228	nonsense	probably null
R0471:Dsp	UTSW	13	38193350	nonsense	probably null
R0567:Dsp	UTSW	13	38192438	missense	probably benign	0.01
R0611:Dsp	UTSW	13	38187741	missense	probably damaging	1.00
R0718:Dsp	UTSW	13	38196764	missense	possibly damaging	0.80
R0926:Dsp	UTSW	13	38183218	missense	probably damaging	0.97
R1078:Dsp	UTSW	13	38183106	splice site	probably benign
R1183:Dsp	UTSW	13	38191740	nonsense	probably null
R1188:Dsp	UTSW	13	38194963	missense	probably damaging	1.00
R1419:Dsp	UTSW	13	38186695	missense	probably damaging	1.00
R1445:Dsp	UTSW	13	38191931	missense	probably damaging	0.98
R1467:Dsp	UTSW	13	38192712	missense	probably benign	0.00
R1467:Dsp	UTSW	13	38192712	missense	probably benign	0.00
R1478:Dsp	UTSW	13	38181138	missense	probably damaging	1.00
R1568:Dsp	UTSW	13	38175147	missense	probably damaging	1.00
R1572:Dsp	UTSW	13	38195738	missense	probably damaging	1.00
R1676:Dsp	UTSW	13	38193374	nonsense	probably null
R1736:Dsp	UTSW	13	38192990	missense	probably benign	0.01
R1776:Dsp	UTSW	13	38196617	missense	probably damaging	0.99
R1829:Dsp	UTSW	13	38193195	missense	probably damaging	1.00
R1878:Dsp	UTSW	13	38164855	missense	possibly damaging	0.53
R2013:Dsp	UTSW	13	38191458	missense	probably damaging	1.00
R2161:Dsp	UTSW	13	38196451	missense	probably damaging	1.00
R2187:Dsp	UTSW	13	38176407	missense	probably damaging	1.00
R2295:Dsp	UTSW	13	38197046	missense	probably benign	0.28
R2495:Dsp	UTSW	13	38193477	missense	possibly damaging	0.91
R2566:Dsp	UTSW	13	38196404	missense	probably damaging	1.00
R2888:Dsp	UTSW	13	38192248	missense	possibly damaging	0.92
R3012:Dsp	UTSW	13	38193342	missense	possibly damaging	0.61
R3614:Dsp	UTSW	13	38177199	missense	probably damaging	0.98
R3725:Dsp	UTSW	13	38194689	splice site	probably null
R3725:Dsp	UTSW	13	38197618	missense	probably benign	0.00
R3797:Dsp	UTSW	13	38177284	critical splice donor site	probably null
R3841:Dsp	UTSW	13	38197705	missense	probably benign
R4030:Dsp	UTSW	13	38191428	missense	possibly damaging	0.84
R4124:Dsp	UTSW	13	38186713	missense	probably damaging	1.00
R4279:Dsp	UTSW	13	38185231	missense	probably damaging	1.00
R4334:Dsp	UTSW	13	38196664	missense	possibly damaging	0.46
R4419:Dsp	UTSW	13	38195132	missense	probably damaging	1.00
R4615:Dsp	UTSW	13	38191632	missense	probably damaging	0.98
R4627:Dsp	UTSW	13	38168641	missense	probably benign	0.01
R4639:Dsp	UTSW	13	38196784	missense	probably damaging	1.00
R4687:Dsp	UTSW	13	38191619	missense	probably damaging	1.00
R4746:Dsp	UTSW	13	38195104	missense	possibly damaging	0.51
R4772:Dsp	UTSW	13	38167528	nonsense	probably null
R4830:Dsp	UTSW	13	38192864	missense	probably benign
R4850:Dsp	UTSW	13	38192469	missense	probably damaging	1.00
R4959:Dsp	UTSW	13	38191710	missense	probably benign	0.41
R4963:Dsp	UTSW	13	38197870	missense	probably damaging	0.99
R4969:Dsp	UTSW	13	38192910	missense	probably benign	0.00
R4978:Dsp	UTSW	13	38182234	missense	probably damaging	1.00
R4989:Dsp	UTSW	13	38197702	missense	possibly damaging	0.93
R5068:Dsp	UTSW	13	38197123	missense	possibly damaging	0.78
R5069:Dsp	UTSW	13	38197123	missense	possibly damaging	0.78
R5070:Dsp	UTSW	13	38197123	missense	possibly damaging	0.78
R5133:Dsp	UTSW	13	38197702	missense	possibly damaging	0.93
R5138:Dsp	UTSW	13	38183298	missense	probably benign	0.37
R5138:Dsp	UTSW	13	38195845	missense	possibly damaging	0.50
R5153:Dsp	UTSW	13	38182306	missense	probably damaging	1.00
R5199:Dsp	UTSW	13	38192902	nonsense	probably null
R5226:Dsp	UTSW	13	38186770	missense	probably damaging	0.99
R5265:Dsp	UTSW	13	38195183	missense	possibly damaging	0.95
R5371:Dsp	UTSW	13	38194889	missense	probably damaging	0.97
R5484:Dsp	UTSW	13	38184038	missense	possibly damaging	0.48
R5534:Dsp	UTSW	13	38195842	missense	probably benign	0.01
R5569:Dsp	UTSW	13	38192652	missense	probably benign	0.01
R5854:Dsp	UTSW	13	38167501	splice site	probably null
R5910:Dsp	UTSW	13	38192469	missense	possibly damaging	0.95
R5929:Dsp	UTSW	13	38195434	missense	possibly damaging	0.92
R5940:Dsp	UTSW	13	38196026	missense	possibly damaging	0.70
R5948:Dsp	UTSW	13	38195401	missense	possibly damaging	0.95
R5955:Dsp	UTSW	13	38194958	missense	possibly damaging	0.73
R5970:Dsp	UTSW	13	38195702	missense	possibly damaging	0.93
R6054:Dsp	UTSW	13	38167609	missense	probably benign	0.00
R6113:Dsp	UTSW	13	38192047	missense	probably damaging	1.00
R6139:Dsp	UTSW	13	38192406	missense	probably damaging	0.97
R6328:Dsp	UTSW	13	38197006	nonsense	probably null
R6527:Dsp	UTSW	13	38195873	missense	probably damaging	1.00
R6573:Dsp	UTSW	13	38196862	missense	probably damaging	1.00
R6628:Dsp	UTSW	13	38167622	missense	possibly damaging	0.73
R6738:Dsp	UTSW	13	38192210	missense	possibly damaging	0.87
R6898:Dsp	UTSW	13	38192217	missense	possibly damaging	0.59
R6919:Dsp	UTSW	13	38167655	missense	possibly damaging	0.84
R6951:Dsp	UTSW	13	38167646	missense	possibly damaging	0.95
R7017:Dsp	UTSW	13	38186707	missense	probably benign	0.02
R7022:Dsp	UTSW	13	38191740	missense	probably benign	0.06
R7135:Dsp	UTSW	13	38179073	missense	probably damaging	1.00
R7192:Dsp	UTSW	13	38195593	missense	probably benign	0.09
R7211:Dsp	UTSW	13	38188535	critical splice donor site	probably null
R7251:Dsp	UTSW	13	38193548	missense	probably benign	0.02
R7326:Dsp	UTSW	13	38192883	missense	probably benign	0.01
R7369:Dsp	UTSW	13	38197525	missense	possibly damaging	0.82
R7376:Dsp	UTSW	13	38172843	missense	probably damaging	1.00
R7406:Dsp	UTSW	13	38197196	missense	possibly damaging	0.63
R7439:Dsp	UTSW	13	38176502	critical splice donor site	probably null
R7439:Dsp	UTSW	13	38195449	missense	probably benign	0.00
R7441:Dsp	UTSW	13	38195449	missense	probably benign	0.00
R7477:Dsp	UTSW	13	38172863	missense	probably damaging	1.00
R7535:Dsp	UTSW	13	38192789	missense	probably benign	0.05
R7558:Dsp	UTSW	13	38168766	missense	probably benign	0.02
R7600:Dsp	UTSW	13	38191715	missense	probably damaging	1.00
R7616:Dsp	UTSW	13	38191482	missense	probably damaging	0.98
R7702:Dsp	UTSW	13	38175207	missense	possibly damaging	0.83
R7738:Dsp	UTSW	13	38185175	missense	probably damaging	0.97
R7815:Dsp	UTSW	13	38191470	missense	probably benign	0.31
R7882:Dsp	UTSW	13	38184018	missense	possibly damaging	0.76
R7917:Dsp	UTSW	13	38167639	nonsense	probably null
R7971:Dsp	UTSW	13	38192523	missense	probably damaging	0.97
R8104:Dsp	UTSW	13	38168624	missense	probably benign	0.03
R8176:Dsp	UTSW	13	38192810	missense	possibly damaging	0.56
R8303:Dsp	UTSW	13	38197343	missense	probably benign
R8323:Dsp	UTSW	13	38172830	missense	possibly damaging	0.80
R8326:Dsp	UTSW	13	38191635	missense	probably damaging	1.00
R8358:Dsp	UTSW	13	38192481	missense	possibly damaging	0.92
R8410:Dsp	UTSW	13	38196815	missense	possibly damaging	0.94
R8552:Dsp	UTSW	13	38185141	missense	probably damaging	0.98
R8713:Dsp	UTSW	13	38168725	missense	probably damaging	0.99
R8801:Dsp	UTSW	13	38197526	missense	possibly damaging	0.81
R8900:Dsp	UTSW	13	38181179	missense	probably damaging	0.99
R8901:Dsp	UTSW	13	38181179	missense	probably damaging	0.99
R8968:Dsp	UTSW	13	38151620	missense	possibly damaging	0.83
R9014:Dsp	UTSW	13	38192724	missense	possibly damaging	0.83
R9021:Dsp	UTSW	13	38196832	missense	possibly damaging	0.61
R9030:Dsp	UTSW	13	38168697	missense	probably damaging	1.00
R9124:Dsp	UTSW	13	38193300	missense	probably benign	0.42
R9129:Dsp	UTSW	13	38193150	missense	probably benign	0.09
R9143:Dsp	UTSW	13	38193361	missense	probably benign	0.05
R9450:Dsp	UTSW	13	38192403	missense	probably damaging	1.00
R9488:Dsp	UTSW	13	38193242	missense	probably benign	0.04
R9514:Dsp	UTSW	13	38187805	missense	probably benign	0.02
R9789:Dsp	UTSW	13	38183961	missense	probably benign	0.03
R9792:Dsp	UTSW	13	38195518	missense	possibly damaging	0.87
X0023:Dsp	UTSW	13	38197684	missense	probably benign	0.00
X0024:Dsp	UTSW	13	38193255	missense	probably benign	0.04
X0027:Dsp	UTSW	13	38186646	missense	possibly damaging	0.68
X0067:Dsp	UTSW	13	38182312	missense	possibly damaging	0.85
Z1176:Dsp	UTSW	13	38197190	missense	possibly damaging	0.81
Z1177:Dsp	UTSW	13	38151689	missense	probably benign	0.01
Z1177:Dsp	UTSW	13	38192854	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- TCACCAAGAAGAAGGTCAGC -3'
(R):5'- CCTTAAATTGCTGACGGGATCC -3'

Sequencing Primer
(F):5'- AGGTCAGCTACATGCAGC -3'
(R):5'- TTGCTGACGGGATCCACAATAAAG -3'

Posted On

2015-11-11