Incidental Mutation 'R4735:Dsp'
ID356512
Institutional Source Beutler Lab
Gene Symbol Dsp
Ensembl Gene ENSMUSG00000054889
Gene Namedesmoplakin
Synonyms5730453H04Rik, DP, 2300002E22Rik
MMRRC Submission 041962-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4735 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location38151294-38198577 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38196040 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1655 (S1655P)
Ref Sequence ENSEMBL: ENSMUSP00000117252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124830] [ENSMUST00000127906]
Predicted Effect possibly damaging
Transcript: ENSMUST00000124830
AA Change: S2254P

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000115062
Gene: ENSMUSG00000054889
AA Change: S2254P

DomainStartEndE-ValueType
Blast:SPEC 193 282 2e-51 BLAST
SPEC 285 385 6.03e-2 SMART
Blast:SPEC 391 557 1e-96 BLAST
Blast:SPEC 783 894 4e-34 BLAST
SPEC 901 1030 1.39e0 SMART
coiled coil region 1033 1370 N/A INTRINSIC
coiled coil region 1394 1956 N/A INTRINSIC
low complexity region 1997 2011 N/A INTRINSIC
PLEC 2021 2057 3.33e-1 SMART
PLEC 2058 2095 3.76e-9 SMART
PLEC 2096 2133 4.09e-10 SMART
PLEC 2134 2171 2.09e-7 SMART
PLEC 2175 2209 4.83e1 SMART
PLEC 2210 2245 5.67e1 SMART
PLEC 2263 2300 1.22e-8 SMART
PLEC 2301 2338 1.16e-9 SMART
PLEC 2339 2376 1.12e-7 SMART
PLEC 2377 2414 1.56e-6 SMART
PLEC 2418 2452 1.42e0 SMART
PLEC 2468 2505 3.7e-8 SMART
low complexity region 2507 2517 N/A INTRINSIC
PLEC 2519 2556 3.73e-4 SMART
low complexity region 2577 2593 N/A INTRINSIC
PLEC 2622 2659 1.46e-6 SMART
PLEC 2660 2697 6.69e-15 SMART
PLEC 2698 2735 1.98e2 SMART
PLEC 2736 2773 2.35e-10 SMART
PLEC 2774 2811 1.39e-3 SMART
low complexity region 2835 2860 N/A INTRINSIC
low complexity region 2867 2879 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000127906
AA Change: S1655P

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000117252
Gene: ENSMUSG00000054889
AA Change: S1655P

DomainStartEndE-ValueType
Blast:SPEC 193 282 2e-51 BLAST
SPEC 285 385 6.03e-2 SMART
Blast:SPEC 391 557 1e-95 BLAST
Blast:SPEC 783 894 3e-34 BLAST
SPEC 901 1030 1.39e0 SMART
coiled coil region 1033 1357 N/A INTRINSIC
low complexity region 1398 1412 N/A INTRINSIC
PLEC 1422 1458 3.33e-1 SMART
PLEC 1459 1496 3.76e-9 SMART
PLEC 1497 1534 4.09e-10 SMART
PLEC 1535 1572 2.09e-7 SMART
PLEC 1576 1610 4.83e1 SMART
PLEC 1611 1646 5.67e1 SMART
PLEC 1664 1701 1.22e-8 SMART
PLEC 1702 1739 1.16e-9 SMART
PLEC 1740 1777 1.12e-7 SMART
PLEC 1778 1815 1.56e-6 SMART
PLEC 1819 1853 1.42e0 SMART
PLEC 1869 1906 3.7e-8 SMART
low complexity region 1908 1918 N/A INTRINSIC
PLEC 1920 1957 3.73e-4 SMART
low complexity region 1978 1994 N/A INTRINSIC
PLEC 2023 2060 1.46e-6 SMART
PLEC 2061 2098 6.69e-15 SMART
PLEC 2099 2136 1.98e2 SMART
PLEC 2137 2174 2.35e-10 SMART
PLEC 2175 2212 1.39e-3 SMART
low complexity region 2236 2261 N/A INTRINSIC
low complexity region 2268 2280 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that anchors intermediate filaments to desmosomal plaques and forms an obligate component of functional desmosomes. Mutations in this gene are the cause of several cardiomyopathies and keratodermas, including skin fragility-woolly hair syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous targeted null mutants die by embryonic day E6.5 due to instability of desmosomes and tissue integrity; rescue by aggregation with wild-type tetraploid morulae increase embyronic survival with noted major defects in heart muscle, neuroepithelium and epidermis; conditional knockouts that are epidermal-specific have compositionally altered epidermal desmosomes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 133 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T A 12: 71,216,123 I1410N possibly damaging Het
4932411N23Rik T A X: 126,814,594 K296M probably damaging Het
4932438A13Rik T A 3: 37,004,967 N3267K possibly damaging Het
9230106D20Rik T C 10: 19,660,253 noncoding transcript Het
Acsf3 T A 8: 122,781,479 I238N probably damaging Het
Ahctf1 T C 1: 179,753,399 N1746S probably benign Het
Akap3 T C 6: 126,865,638 S407P probably damaging Het
Ankfy1 T A 11: 72,730,611 M241K probably benign Het
Ano7 C A 1: 93,400,494 T622K probably benign Het
App T C 16: 85,103,314 T83A probably damaging Het
Arhgef28 T A 13: 97,899,729 E1674V probably damaging Het
Asb2 C A 12: 103,325,058 V489L probably benign Het
Atrn T C 2: 131,020,990 V1330A probably benign Het
Brca1 A G 11: 101,492,175 probably null Het
Bspry G A 4: 62,486,525 R186Q probably damaging Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Celsr1 T A 15: 85,906,029 probably null Het
Ckap4 A G 10: 84,533,520 V116A possibly damaging Het
Crb3 A G 17: 57,065,207 T85A probably damaging Het
Cyld T C 8: 88,729,650 S443P probably damaging Het
Cyp27a1 T G 1: 74,737,207 V434G possibly damaging Het
Cyp2b13 A G 7: 26,088,295 T339A probably benign Het
Dars A T 1: 128,376,234 L252* probably null Het
Dcaf10 G A 4: 45,372,769 R394Q possibly damaging Het
Ddx55 T C 5: 124,566,476 F382S probably damaging Het
Dnah7b G A 1: 46,066,955 R33Q unknown Het
Dnm2 G T 9: 21,474,587 S302I probably damaging Het
Dock4 T A 12: 40,631,526 F75I probably benign Het
Dpp10 T C 1: 123,398,627 N365S probably benign Het
Dpy19l3 G T 7: 35,722,721 Q236K probably benign Het
Ebpl A T 14: 61,342,118 I117N probably damaging Het
Edc4 T A 8: 105,887,186 V386E probably damaging Het
Eif2s2 T A 2: 154,878,547 probably null Het
Elob A T 17: 23,827,588 probably null Het
Enox2 T C X: 49,069,677 I71V probably damaging Het
Fam160b1 A G 19: 57,371,229 E67G probably damaging Het
Fez1 A T 9: 36,860,845 K149* probably null Het
Fign A G 2: 63,980,438 Y163H probably damaging Het
Flnc G A 6: 29,455,813 G2048S probably damaging Het
Fras1 A G 5: 96,588,163 D539G probably benign Het
Frmd4b T C 6: 97,459,259 probably benign Het
Gan C T 8: 117,194,231 T402M probably damaging Het
Ganc T A 2: 120,436,623 silent Het
Ggt6 C A 11: 72,436,599 R103S probably benign Het
Gli2 T C 1: 118,840,322 D725G probably damaging Het
Gm15446 T A 5: 109,942,952 C357S probably damaging Het
Gm44501 A G 17: 40,578,919 N108S probably benign Het
Gm6309 A T 5: 146,168,244 D286E probably damaging Het
Gm6358 G A 16: 89,140,960 G29E unknown Het
Gm8251 A G 1: 44,061,701 I79T probably benign Het
Grik5 A G 7: 25,058,288 I422T probably damaging Het
Grin2c A G 11: 115,249,596 I1232T possibly damaging Het
Gsg1 C T 6: 135,237,407 R365H possibly damaging Het
H2-M2 A G 17: 37,483,244 S30P possibly damaging Het
Hcfc2 A G 10: 82,712,080 D302G probably damaging Het
Hk2 T C 6: 82,744,974 D128G probably benign Het
Hmcn2 C A 2: 31,383,775 Q1380K probably benign Het
Hsp90b1 G T 10: 86,693,955 P617T probably damaging Het
Htr1d A G 4: 136,442,886 E142G probably benign Het
Hydin G A 8: 110,555,632 probably null Het
Il1r1 T A 1: 40,293,295 N81K probably benign Het
Inpp5b T C 4: 124,783,967 S407P probably damaging Het
Itpkb T C 1: 180,418,215 Y766H probably damaging Het
Lyrm2 T A 4: 32,801,150 I65N probably damaging Het
Mink1 T A 11: 70,609,260 probably null Het
Mkrn3 C T 7: 62,419,704 R113H probably damaging Het
Msx3 G A 7: 140,047,885 A157V probably damaging Het
Nrxn2 T G 19: 6,498,454 V59G possibly damaging Het
Nt5c3b T C 11: 100,440,906 T12A probably benign Het
Nwd2 G A 5: 63,808,251 R1726Q probably benign Het
Nynrin A G 14: 55,870,168 T911A probably benign Het
Olfr1179 T C 2: 88,402,923 T4A probably benign Het
Olfr266 T A 3: 106,821,680 Y293F probably damaging Het
Olfr490 A G 7: 108,286,313 M271T probably benign Het
Olfr609 C T 7: 103,492,060 V273M possibly damaging Het
Olfr611 A G 7: 103,517,823 I187T possibly damaging Het
Olfr659 C T 7: 104,670,993 T97I probably benign Het
Olfr805 A G 10: 129,722,923 I207T probably benign Het
Patl1 G T 19: 11,922,505 M220I probably benign Het
Pcnx2 A T 8: 125,828,041 probably null Het
Pigr A T 1: 130,846,554 T424S probably damaging Het
Pik3c2b T A 1: 133,067,049 D250E probably benign Het
Ppa2 G A 3: 133,370,425 E272K probably benign Het
Pramel7 G A 2: 87,490,843 Q283* probably null Het
Prelid3b A G 2: 174,465,890 I81T probably benign Het
Prpf38a T C 4: 108,579,045 I24V possibly damaging Het
Ptger2 A G 14: 45,001,838 D311G possibly damaging Het
Rab4b A T 7: 27,172,766 probably benign Het
Rad17 A C 13: 100,619,129 D581E probably damaging Het
Samd11 T C 4: 156,248,773 T333A probably benign Het
Scaf4 C T 16: 90,252,432 D256N unknown Het
Serinc2 A G 4: 130,263,645 F82L probably benign Het
Serpina3g T A 12: 104,239,113 V37E probably damaging Het
Serpinb9c T A 13: 33,150,271 M263L probably benign Het
Shbg A G 11: 69,617,500 I67T possibly damaging Het
Slc25a48 G A 13: 56,449,074 probably null Het
Slc25a54 T C 3: 109,098,607 W144R probably damaging Het
Slc34a1 A T 13: 55,413,584 T621S probably benign Het
Slc6a18 A T 13: 73,666,435 C419S probably benign Het
Smc5 A T 19: 23,242,705 D389E probably benign Het
Smco3 T A 6: 136,831,638 E79D probably damaging Het
Sox5 A G 6: 143,960,835 F298S probably damaging Het
Sphkap A G 1: 83,279,117 S304P probably benign Het
Tcea2 C T 2: 181,686,721 T211I probably damaging Het
Tcf4 G T 18: 69,564,155 S34I possibly damaging Het
Tlr4 C T 4: 66,841,198 R743C probably damaging Het
Tmem183a T C 1: 134,360,882 E67G probably damaging Het
Tpr C T 1: 150,442,196 R2152C possibly damaging Het
Trbv15 T C 6: 41,141,424 I38T probably benign Het
Treh G A 9: 44,681,552 A125T probably damaging Het
Trio A T 15: 27,752,789 probably null Het
Ttn A G 2: 76,951,949 V981A probably damaging Het
Uap1l1 A G 2: 25,362,720 L436P probably damaging Het
Uba7 A T 9: 107,976,916 I182F possibly damaging Het
Unc13c A T 9: 73,693,338 S1375T probably benign Het
Usp48 C CT 4: 137,633,369 probably null Het
Utp20 A C 10: 88,816,918 V378G possibly damaging Het
Vmn1r69 A T 7: 10,580,999 probably benign Het
Vmn1r86 A T 7: 13,102,294 H218Q probably damaging Het
Vmn2r121 T A X: 124,128,638 I562L probably benign Het
Vmn2r45 A T 7: 8,483,473 I272N probably damaging Het
Wdr90 A G 17: 25,859,450 V320A probably benign Het
Wfikkn1 A G 17: 25,878,393 V319A possibly damaging Het
Whamm A G 7: 81,571,374 D18G probably benign Het
Wrn T A 8: 33,285,222 I605F probably damaging Het
Zdhhc18 A G 4: 133,613,867 F232L probably damaging Het
Zfp41 T C 15: 75,618,760 I187T probably benign Het
Zfp418 A G 7: 7,182,562 Y508C probably damaging Het
Zfp560 T G 9: 20,349,051 I172L probably benign Het
Zfp943 A T 17: 21,992,410 D159V probably benign Het
Zfp955a T C 17: 33,241,722 I479V probably benign Het
Zfpm1 T A 8: 122,335,480 V426D probably benign Het
Zic1 C T 9: 91,364,505 M171I possibly damaging Het
Other mutations in Dsp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Dsp APN 13 38197846 missense probably damaging 0.99
IGL01337:Dsp APN 13 38192687 missense probably benign 0.44
IGL01371:Dsp APN 13 38193617 missense probably benign 0.13
IGL01473:Dsp APN 13 38167571 missense probably damaging 0.99
IGL01660:Dsp APN 13 38176495 missense possibly damaging 0.90
IGL01723:Dsp APN 13 38179084 missense probably damaging 1.00
IGL01999:Dsp APN 13 38181186 missense probably damaging 0.99
IGL02313:Dsp APN 13 38196523 nonsense probably null
IGL02833:Dsp APN 13 38192921 missense possibly damaging 0.56
IGL03050:Dsp APN 13 38188445 splice site probably benign
IGL03353:Dsp APN 13 38186695 missense probably damaging 1.00
R0052:Dsp UTSW 13 38197364 missense possibly damaging 0.93
R0052:Dsp UTSW 13 38197364 missense possibly damaging 0.93
R0078:Dsp UTSW 13 38196017 missense probably benign 0.22
R0230:Dsp UTSW 13 38197705 missense probably benign 0.03
R0234:Dsp UTSW 13 38187893 missense probably benign 0.13
R0234:Dsp UTSW 13 38187893 missense probably benign 0.13
R0285:Dsp UTSW 13 38172794 missense probably benign
R0326:Dsp UTSW 13 38192870 nonsense probably null
R0332:Dsp UTSW 13 38182228 nonsense probably null
R0471:Dsp UTSW 13 38193350 nonsense probably null
R0567:Dsp UTSW 13 38192438 missense probably benign 0.01
R0611:Dsp UTSW 13 38187741 missense probably damaging 1.00
R0718:Dsp UTSW 13 38196764 missense possibly damaging 0.80
R0926:Dsp UTSW 13 38183218 missense probably damaging 0.97
R1078:Dsp UTSW 13 38183106 splice site probably benign
R1183:Dsp UTSW 13 38191740 nonsense probably null
R1188:Dsp UTSW 13 38194963 missense probably damaging 1.00
R1419:Dsp UTSW 13 38186695 missense probably damaging 1.00
R1445:Dsp UTSW 13 38191931 missense probably damaging 0.98
R1467:Dsp UTSW 13 38192712 missense probably benign 0.00
R1467:Dsp UTSW 13 38192712 missense probably benign 0.00
R1478:Dsp UTSW 13 38181138 missense probably damaging 1.00
R1568:Dsp UTSW 13 38175147 missense probably damaging 1.00
R1572:Dsp UTSW 13 38195738 missense probably damaging 1.00
R1676:Dsp UTSW 13 38193374 nonsense probably null
R1736:Dsp UTSW 13 38192990 missense probably benign 0.01
R1776:Dsp UTSW 13 38196617 missense probably damaging 0.99
R1829:Dsp UTSW 13 38193195 missense probably damaging 1.00
R1878:Dsp UTSW 13 38164855 missense possibly damaging 0.53
R2013:Dsp UTSW 13 38191458 missense probably damaging 1.00
R2161:Dsp UTSW 13 38196451 missense probably damaging 1.00
R2187:Dsp UTSW 13 38176407 missense probably damaging 1.00
R2295:Dsp UTSW 13 38197046 missense probably benign 0.28
R2495:Dsp UTSW 13 38193477 missense possibly damaging 0.91
R2566:Dsp UTSW 13 38196404 missense probably damaging 1.00
R2888:Dsp UTSW 13 38192248 missense possibly damaging 0.92
R3012:Dsp UTSW 13 38193342 missense possibly damaging 0.61
R3614:Dsp UTSW 13 38177199 missense probably damaging 0.98
R3725:Dsp UTSW 13 38194689 splice site probably null
R3725:Dsp UTSW 13 38197618 missense probably benign 0.00
R3797:Dsp UTSW 13 38177284 critical splice donor site probably null
R3841:Dsp UTSW 13 38197705 missense probably benign
R4030:Dsp UTSW 13 38191428 missense possibly damaging 0.84
R4124:Dsp UTSW 13 38186713 missense probably damaging 1.00
R4279:Dsp UTSW 13 38185231 missense probably damaging 1.00
R4334:Dsp UTSW 13 38196664 missense possibly damaging 0.46
R4419:Dsp UTSW 13 38195132 missense probably damaging 1.00
R4615:Dsp UTSW 13 38191632 missense probably damaging 0.98
R4627:Dsp UTSW 13 38168641 missense probably benign 0.01
R4639:Dsp UTSW 13 38196784 missense probably damaging 1.00
R4687:Dsp UTSW 13 38191619 missense probably damaging 1.00
R4746:Dsp UTSW 13 38195104 missense possibly damaging 0.51
R4772:Dsp UTSW 13 38167528 nonsense probably null
R4830:Dsp UTSW 13 38192864 missense probably benign
R4850:Dsp UTSW 13 38192469 missense probably damaging 1.00
R4959:Dsp UTSW 13 38191710 missense probably benign 0.41
R4963:Dsp UTSW 13 38197870 missense probably damaging 0.99
R4969:Dsp UTSW 13 38192910 missense probably benign 0.00
R4978:Dsp UTSW 13 38182234 missense probably damaging 1.00
R4989:Dsp UTSW 13 38197702 missense possibly damaging 0.93
R5068:Dsp UTSW 13 38197123 missense possibly damaging 0.78
R5069:Dsp UTSW 13 38197123 missense possibly damaging 0.78
R5070:Dsp UTSW 13 38197123 missense possibly damaging 0.78
R5133:Dsp UTSW 13 38197702 missense possibly damaging 0.93
R5138:Dsp UTSW 13 38183298 missense probably benign 0.37
R5138:Dsp UTSW 13 38195845 missense possibly damaging 0.50
R5153:Dsp UTSW 13 38182306 missense probably damaging 1.00
R5199:Dsp UTSW 13 38192902 nonsense probably null
R5226:Dsp UTSW 13 38186770 missense probably damaging 0.99
R5265:Dsp UTSW 13 38195183 missense possibly damaging 0.95
R5371:Dsp UTSW 13 38194889 missense probably damaging 0.97
R5484:Dsp UTSW 13 38184038 missense possibly damaging 0.48
R5534:Dsp UTSW 13 38195842 missense probably benign 0.01
R5569:Dsp UTSW 13 38192652 missense probably benign 0.01
R5854:Dsp UTSW 13 38167501 splice site probably null
R5910:Dsp UTSW 13 38192469 missense possibly damaging 0.95
R5929:Dsp UTSW 13 38195434 missense possibly damaging 0.92
R5940:Dsp UTSW 13 38196026 missense possibly damaging 0.70
R5948:Dsp UTSW 13 38195401 missense possibly damaging 0.95
R5955:Dsp UTSW 13 38194958 missense possibly damaging 0.73
R5970:Dsp UTSW 13 38195702 missense possibly damaging 0.93
R6054:Dsp UTSW 13 38167609 missense probably benign 0.00
R6113:Dsp UTSW 13 38192047 missense probably damaging 1.00
R6139:Dsp UTSW 13 38192406 missense probably damaging 0.97
R6328:Dsp UTSW 13 38197006 nonsense probably null
R6527:Dsp UTSW 13 38195873 missense probably damaging 1.00
R6573:Dsp UTSW 13 38196862 missense probably damaging 1.00
R6628:Dsp UTSW 13 38167622 missense possibly damaging 0.73
R6738:Dsp UTSW 13 38192210 missense possibly damaging 0.87
R6898:Dsp UTSW 13 38192217 missense possibly damaging 0.59
R6919:Dsp UTSW 13 38167655 missense possibly damaging 0.84
R6951:Dsp UTSW 13 38167646 missense possibly damaging 0.95
R7017:Dsp UTSW 13 38186707 missense probably benign 0.02
R7022:Dsp UTSW 13 38191740 missense probably benign 0.06
R7135:Dsp UTSW 13 38179073 missense probably damaging 1.00
R7192:Dsp UTSW 13 38195593 missense probably benign 0.09
R7211:Dsp UTSW 13 38188535 critical splice donor site probably null
R7251:Dsp UTSW 13 38193548 missense probably benign 0.02
R7326:Dsp UTSW 13 38192883 missense probably benign 0.01
R7369:Dsp UTSW 13 38197525 missense possibly damaging 0.82
R7376:Dsp UTSW 13 38172843 missense probably damaging 1.00
R7406:Dsp UTSW 13 38197196 missense possibly damaging 0.63
R7439:Dsp UTSW 13 38176502 critical splice donor site probably null
R7439:Dsp UTSW 13 38195449 missense probably benign 0.00
R7441:Dsp UTSW 13 38195449 missense probably benign 0.00
R7477:Dsp UTSW 13 38172863 missense probably damaging 1.00
R7535:Dsp UTSW 13 38192789 missense probably benign 0.05
R7558:Dsp UTSW 13 38168766 missense probably benign 0.02
R7600:Dsp UTSW 13 38191715 missense probably damaging 1.00
R7616:Dsp UTSW 13 38191482 missense probably damaging 0.98
R7702:Dsp UTSW 13 38175207 missense possibly damaging 0.83
X0023:Dsp UTSW 13 38197684 missense probably benign 0.00
X0024:Dsp UTSW 13 38193255 missense probably benign 0.04
X0027:Dsp UTSW 13 38186646 missense possibly damaging 0.68
X0067:Dsp UTSW 13 38182312 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TCACCAAGAAGAAGGTCAGC -3'
(R):5'- CCTTAAATTGCTGACGGGATCC -3'

Sequencing Primer
(F):5'- AGGTCAGCTACATGCAGC -3'
(R):5'- TTGCTGACGGGATCCACAATAAAG -3'
Posted On2015-11-11