Incidental Mutation 'R4744:St6galnac6'
ID356549
Institutional Source Beutler Lab
Gene Symbol St6galnac6
Ensembl Gene ENSMUSG00000026811
Gene NameST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6
SynonymsST6GalNAcVI, Siat7f
MMRRC Submission 042027-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R4744 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location32599709-32620806 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32618543 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 231 (I231V)
Ref Sequence ENSEMBL: ENSMUSP00000115430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072111] [ENSMUST00000081879] [ENSMUST00000095044] [ENSMUST00000095045] [ENSMUST00000113278] [ENSMUST00000113290] [ENSMUST00000126636] [ENSMUST00000128811] [ENSMUST00000131229] [ENSMUST00000140983] [ENSMUST00000143625] [ENSMUST00000183538]
Predicted Effect probably damaging
Transcript: ENSMUST00000072111
AA Change: I251V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000071983
Gene: ENSMUSG00000026811
AA Change: I251V

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:Glyco_transf_29 55 328 2.5e-38 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000081879
AA Change: I253V

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000080555
Gene: ENSMUSG00000026811
AA Change: I253V

DomainStartEndE-ValueType
low complexity region 17 29 N/A INTRINSIC
Pfam:Glyco_transf_29 62 329 2.1e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000095044
AA Change: I251V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000092654
Gene: ENSMUSG00000026811
AA Change: I251V

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:Glyco_transf_29 55 328 2.5e-38 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000095045
AA Change: I217V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092655
Gene: ENSMUSG00000026811
AA Change: I217V

DomainStartEndE-ValueType
Pfam:Glyco_transf_29 41 307 1.8e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113278
SMART Domains Protein: ENSMUSP00000108903
Gene: ENSMUSG00000026817

DomainStartEndE-ValueType
Pfam:AAA_33 10 159 2.7e-10 PFAM
Pfam:AAA_17 10 171 5.4e-11 PFAM
Pfam:AAA_18 11 149 7.6e-8 PFAM
Pfam:ADK 13 169 7.5e-56 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113290
AA Change: I217V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108915
Gene: ENSMUSG00000026811
AA Change: I217V

DomainStartEndE-ValueType
Pfam:Glyco_transf_29 21 294 1.7e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126636
Predicted Effect probably benign
Transcript: ENSMUST00000128811
SMART Domains Protein: ENSMUSP00000118893
Gene: ENSMUSG00000026811

DomainStartEndE-ValueType
Pfam:Glyco_transf_29 20 108 7e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000131229
AA Change: I231V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115430
Gene: ENSMUSG00000026811
AA Change: I231V

DomainStartEndE-ValueType
Pfam:Glyco_transf_29 35 176 3.3e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000140983
AA Change: I217V

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114934
Gene: ENSMUSG00000026811
AA Change: I217V

DomainStartEndE-ValueType
Pfam:Glyco_transf_29 21 229 7.3e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143625
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149220
Predicted Effect probably benign
Transcript: ENSMUST00000183538
SMART Domains Protein: ENSMUSP00000138916
Gene: ENSMUSG00000026811

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:Glyco_transf_29 55 232 4.8e-24 PFAM
Meta Mutation Damage Score 0.1715 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ST6GALNAC6 belongs to a family of sialyltransferases that modify proteins and ceramides on the cell surface to alter cell-cell or cell-extracellular matrix interactions (Tsuchida et al., 2003 [PubMed 12668675]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik T C 5: 114,879,556 S143P possibly damaging Het
4933427D14Rik T C 11: 72,175,539 K614E probably damaging Het
Aatk A G 11: 120,016,122 M155T possibly damaging Het
Acvr2b T C 9: 119,431,262 L333P probably damaging Het
Adam22 T C 5: 8,078,699 E865G probably damaging Het
Add2 A G 6: 86,110,888 S358G probably damaging Het
Agap2 T C 10: 127,090,203 probably null Het
Alkbh8 G A 9: 3,344,604 W49* probably null Het
AU015228 A T 2: 130,100,629 noncoding transcript Het
Bank1 G T 3: 136,247,689 R102S probably benign Het
Brap T A 5: 121,662,130 D27E probably damaging Het
Cyb5r2 G T 7: 107,750,277 H276N possibly damaging Het
Dhh A G 15: 98,894,258 F290L possibly damaging Het
Dhrs7 T A 12: 72,652,251 N319I possibly damaging Het
Ebpl A G 14: 61,360,233 V53A probably damaging Het
Eif3j2 TGCCGCCGCCGCCGCCGCCGCCGCCGCC TGCCGCCGCCGCCGCCGCCGCCGCC 18: 43,477,717 probably benign Het
Etnk1 A C 6: 143,186,593 N220T probably damaging Het
F11r T A 1: 171,460,598 V64D probably benign Het
Fam171a1 T C 2: 3,224,909 S360P probably damaging Het
Fignl1 A G 11: 11,801,585 M490T probably damaging Het
Fpr-rs7 A T 17: 20,114,003 M75K probably benign Het
Fzd7 T A 1: 59,484,436 F493I possibly damaging Het
Galnt14 G T 17: 73,507,833 P412T probably damaging Het
Gcg T A 2: 62,478,631 S60C probably damaging Het
Ggt1 A G 10: 75,585,899 K527E probably benign Het
Gm14085 A T 2: 122,522,805 K489* probably null Het
Gm16551 T A 9: 74,850,871 noncoding transcript Het
Gm9972 A G 11: 43,036,690 K55E unknown Het
Gpr141 T A 13: 19,751,714 D297V probably benign Het
Grin2b G A 6: 135,778,699 S539L probably damaging Het
Hhipl1 A T 12: 108,319,979 N515I possibly damaging Het
Hmcn1 T G 1: 150,577,612 E5317D probably damaging Het
Hsf5 T A 11: 87,622,791 N227K probably benign Het
Igfn1 A T 1: 135,982,458 D129E probably benign Het
Invs T C 4: 48,397,609 F339L probably damaging Het
Jak2 T A 19: 29,262,256 S17T probably benign Het
Mdga2 T A 12: 66,797,727 I166F probably benign Het
Nck1 T C 9: 100,506,744 I6V probably benign Het
Neb T C 2: 52,150,577 D6624G probably benign Het
Nmur2 A G 11: 56,040,835 Y17H probably benign Het
Nwd2 T C 5: 63,806,967 L1298P probably damaging Het
Ocel1 A G 8: 71,372,753 E161G probably damaging Het
Olfr345 A T 2: 36,640,979 probably null Het
Pabpc2 A G 18: 39,774,828 Y382C probably benign Het
Panx1 A G 9: 15,010,298 probably benign Het
Pdhx A T 2: 103,042,296 V147D probably benign Het
Pigz A T 16: 31,945,333 H403L probably damaging Het
Pilra T C 5: 137,835,507 probably null Het
Rbm47 T C 5: 66,026,693 D189G probably damaging Het
Rhobtb2 A G 14: 69,794,002 L558P probably damaging Het
Scarf2 G A 16: 17,803,516 R322H probably damaging Het
Sept3 T C 15: 82,290,457 probably null Het
Sirt2 T C 7: 28,777,013 F26L probably damaging Het
Slc1a1 A T 19: 28,894,525 T133S probably benign Het
Slc1a2 A G 2: 102,737,869 I84V probably benign Het
Slc6a9 A T 4: 117,867,895 Q562L probably benign Het
Snx29 C T 16: 11,349,909 Q25* probably null Het
Stard9 A G 2: 120,696,123 T954A probably benign Het
Sufu A G 19: 46,483,630 M443V possibly damaging Het
Sv2b T C 7: 75,206,518 D8G probably benign Het
Tapbpl G A 6: 125,228,285 R233W probably damaging Het
Tex10 A G 4: 48,469,990 L25S probably benign Het
Trp53bp1 A T 2: 121,211,313 V1254D probably damaging Het
Ugt3a1 T A 15: 9,310,553 I307N probably benign Het
Unc13c T C 9: 73,931,844 D575G probably damaging Het
Usf2 A T 7: 30,954,772 D166E probably damaging Het
Usp25 T A 16: 77,114,989 L969M probably damaging Het
Usp32 G A 11: 84,994,393 P1276L probably damaging Het
Vmn2r8 T A 5: 108,808,581 E58D probably benign Het
Zfp462 G T 4: 55,011,598 C40F probably damaging Het
Other mutations in St6galnac6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02736:St6galnac6 APN 2 32614971 missense probably benign 0.04
R0097:St6galnac6 UTSW 2 32599802 missense probably damaging 0.99
R1547:St6galnac6 UTSW 2 32614965 missense possibly damaging 0.75
R1654:St6galnac6 UTSW 2 32619509 missense probably damaging 1.00
R4385:St6galnac6 UTSW 2 32615024 missense possibly damaging 0.84
R4968:St6galnac6 UTSW 2 32608086 missense probably benign 0.00
R5169:St6galnac6 UTSW 2 32614845 missense possibly damaging 0.91
R6037:St6galnac6 UTSW 2 32612228 missense probably damaging 1.00
R6037:St6galnac6 UTSW 2 32612228 missense probably damaging 1.00
R7883:St6galnac6 UTSW 2 32614929 missense probably benign 0.02
R7966:St6galnac6 UTSW 2 32614929 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACCGGTGTCTGATATAGAGGC -3'
(R):5'- ACTCAGCTTGGAGTGGAAGC -3'

Sequencing Primer
(F):5'- CGGTGTCTGATATAGAGGCAGAGC -3'
(R):5'- TGGGGCATCTCCAAGAAGC -3'
Posted On2015-11-11