Incidental Mutation 'R4744:Pdhx'
ID356554
Institutional Source Beutler Lab
Gene Symbol Pdhx
Ensembl Gene ENSMUSG00000010914
Gene Namepyruvate dehydrogenase complex, component X
SynonymsPdx1
MMRRC Submission 042027-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4744 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location103021075-103073513 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103042296 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 147 (V147D)
Ref Sequence ENSEMBL: ENSMUSP00000106814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011058] [ENSMUST00000111183] [ENSMUST00000132449]
Predicted Effect probably benign
Transcript: ENSMUST00000011058
AA Change: V147D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000011058
Gene: ENSMUSG00000010914
AA Change: V147D

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
Pfam:Biotin_lipoyl 57 131 1.3e-21 PFAM
low complexity region 148 172 N/A INTRINSIC
Pfam:E3_binding 182 217 5e-9 PFAM
low complexity region 233 249 N/A INTRINSIC
Pfam:2-oxoacid_dh 272 501 8.4e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111183
AA Change: V147D

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000106814
Gene: ENSMUSG00000010914
AA Change: V147D

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
Pfam:Biotin_lipoyl 57 131 1.8e-21 PFAM
low complexity region 148 172 N/A INTRINSIC
Pfam:E3_binding 180 216 6.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132449
AA Change: V82D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000119172
Gene: ENSMUSG00000010914
AA Change: V82D

DomainStartEndE-ValueType
Pfam:Biotin_lipoyl 5 66 1.3e-14 PFAM
low complexity region 83 107 N/A INTRINSIC
Pfam:E3_binding 115 153 6.1e-14 PFAM
low complexity region 168 184 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The pyruvate dehydrogenase (PDH) complex is located in the mitochondrial matrix and catalyzes the conversion of pyruvate to acetyl coenzyme A. The PDH complex thereby links glycolysis to Krebs cycle. The PDH complex contains three catalytic subunits, E1, E2, and E3, two regulatory subunits, E1 kinase and E1 phosphatase, and a non-catalytic subunit, E3 binding protein (E3BP). This gene encodes the E3 binding protein subunit; also known as component X of the pyruvate dehydrogenase complex. This protein tethers E3 dimers to the E2 core of the PDH complex. Defects in this gene are a cause of pyruvate dehydrogenase deficiency which results in neurological dysfunction and lactic acidosis in infancy and early childhood. This protein is also a minor antigen for antimitochondrial antibodies. These autoantibodies are present in nearly 95% of patients with the autoimmune liver disease primary biliary cirrhosis (PBC). In PBC, activated T lymphocytes attack and destroy epithelial cells in the bile duct where this protein is abnormally distributed and overexpressed. PBC eventually leads to cirrhosis and liver failure. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik T C 5: 114,879,556 S143P possibly damaging Het
4933427D14Rik T C 11: 72,175,539 K614E probably damaging Het
Aatk A G 11: 120,016,122 M155T possibly damaging Het
Acvr2b T C 9: 119,431,262 L333P probably damaging Het
Adam22 T C 5: 8,078,699 E865G probably damaging Het
Add2 A G 6: 86,110,888 S358G probably damaging Het
Agap2 T C 10: 127,090,203 probably null Het
Alkbh8 G A 9: 3,344,604 W49* probably null Het
AU015228 A T 2: 130,100,629 noncoding transcript Het
Bank1 G T 3: 136,247,689 R102S probably benign Het
Brap T A 5: 121,662,130 D27E probably damaging Het
Cyb5r2 G T 7: 107,750,277 H276N possibly damaging Het
Dhh A G 15: 98,894,258 F290L possibly damaging Het
Dhrs7 T A 12: 72,652,251 N319I possibly damaging Het
Ebpl A G 14: 61,360,233 V53A probably damaging Het
Eif3j2 TGCCGCCGCCGCCGCCGCCGCCGCCGCC TGCCGCCGCCGCCGCCGCCGCCGCC 18: 43,477,717 probably benign Het
Etnk1 A C 6: 143,186,593 N220T probably damaging Het
F11r T A 1: 171,460,598 V64D probably benign Het
Fam171a1 T C 2: 3,224,909 S360P probably damaging Het
Fignl1 A G 11: 11,801,585 M490T probably damaging Het
Fpr-rs7 A T 17: 20,114,003 M75K probably benign Het
Fzd7 T A 1: 59,484,436 F493I possibly damaging Het
Galnt14 G T 17: 73,507,833 P412T probably damaging Het
Gcg T A 2: 62,478,631 S60C probably damaging Het
Ggt1 A G 10: 75,585,899 K527E probably benign Het
Gm14085 A T 2: 122,522,805 K489* probably null Het
Gm16551 T A 9: 74,850,871 noncoding transcript Het
Gm9972 A G 11: 43,036,690 K55E unknown Het
Gpr141 T A 13: 19,751,714 D297V probably benign Het
Grin2b G A 6: 135,778,699 S539L probably damaging Het
Hhipl1 A T 12: 108,319,979 N515I possibly damaging Het
Hmcn1 T G 1: 150,577,612 E5317D probably damaging Het
Hsf5 T A 11: 87,622,791 N227K probably benign Het
Igfn1 A T 1: 135,982,458 D129E probably benign Het
Invs T C 4: 48,397,609 F339L probably damaging Het
Jak2 T A 19: 29,262,256 S17T probably benign Het
Mdga2 T A 12: 66,797,727 I166F probably benign Het
Nck1 T C 9: 100,506,744 I6V probably benign Het
Neb T C 2: 52,150,577 D6624G probably benign Het
Nmur2 A G 11: 56,040,835 Y17H probably benign Het
Nwd2 T C 5: 63,806,967 L1298P probably damaging Het
Ocel1 A G 8: 71,372,753 E161G probably damaging Het
Olfr345 A T 2: 36,640,979 probably null Het
Pabpc2 A G 18: 39,774,828 Y382C probably benign Het
Panx1 A G 9: 15,010,298 probably benign Het
Pigz A T 16: 31,945,333 H403L probably damaging Het
Pilra T C 5: 137,835,507 probably null Het
Rbm47 T C 5: 66,026,693 D189G probably damaging Het
Rhobtb2 A G 14: 69,794,002 L558P probably damaging Het
Scarf2 G A 16: 17,803,516 R322H probably damaging Het
Sept3 T C 15: 82,290,457 probably null Het
Sirt2 T C 7: 28,777,013 F26L probably damaging Het
Slc1a1 A T 19: 28,894,525 T133S probably benign Het
Slc1a2 A G 2: 102,737,869 I84V probably benign Het
Slc6a9 A T 4: 117,867,895 Q562L probably benign Het
Snx29 C T 16: 11,349,909 Q25* probably null Het
St6galnac6 A G 2: 32,618,543 I231V probably damaging Het
Stard9 A G 2: 120,696,123 T954A probably benign Het
Sufu A G 19: 46,483,630 M443V possibly damaging Het
Sv2b T C 7: 75,206,518 D8G probably benign Het
Tapbpl G A 6: 125,228,285 R233W probably damaging Het
Tex10 A G 4: 48,469,990 L25S probably benign Het
Trp53bp1 A T 2: 121,211,313 V1254D probably damaging Het
Ugt3a1 T A 15: 9,310,553 I307N probably benign Het
Unc13c T C 9: 73,931,844 D575G probably damaging Het
Usf2 A T 7: 30,954,772 D166E probably damaging Het
Usp25 T A 16: 77,114,989 L969M probably damaging Het
Usp32 G A 11: 84,994,393 P1276L probably damaging Het
Vmn2r8 T A 5: 108,808,581 E58D probably benign Het
Zfp462 G T 4: 55,011,598 C40F probably damaging Het
Other mutations in Pdhx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02147:Pdhx APN 2 103030341 unclassified probably benign
IGL02450:Pdhx APN 2 103042249 missense probably benign 0.00
R0152:Pdhx UTSW 2 103028280 missense probably benign 0.04
R0317:Pdhx UTSW 2 103028280 missense probably benign 0.04
R2351:Pdhx UTSW 2 103024217 nonsense probably null
R3937:Pdhx UTSW 2 103022219 missense probably damaging 1.00
R3950:Pdhx UTSW 2 103035241 missense probably damaging 0.99
R4546:Pdhx UTSW 2 103073397 missense probably null 0.99
R4677:Pdhx UTSW 2 103073466 unclassified probably null
R4996:Pdhx UTSW 2 103030312 missense probably damaging 1.00
R5000:Pdhx UTSW 2 103041040 splice site probably null
R5076:Pdhx UTSW 2 103041077 missense probably damaging 0.99
R5682:Pdhx UTSW 2 103035340 missense probably benign 0.00
R6246:Pdhx UTSW 2 103046792 missense probably damaging 1.00
R6850:Pdhx UTSW 2 103041100 missense probably damaging 1.00
R7141:Pdhx UTSW 2 103073314 missense probably benign 0.21
R7219:Pdhx UTSW 2 103028415 missense probably benign 0.01
R7460:Pdhx UTSW 2 103046779 missense probably damaging 1.00
R7552:Pdhx UTSW 2 103046754 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGATGATGCTGATTTCAAACCC -3'
(R):5'- GAAGAGCCCTCTGTCTTCAG -3'

Sequencing Primer
(F):5'- TGTTCACATAAACGCACTC -3'
(R):5'- CAGTGTCCTTTAGCTCAGGTC -3'
Posted On2015-11-11