Incidental Mutation 'R4744:Trp53bp1'
ID356556
Institutional Source Beutler Lab
Gene Symbol Trp53bp1
Ensembl Gene ENSMUSG00000043909
Gene Nametransformation related protein 53 binding protein 1
Synonyms53BP1, p53BP1
MMRRC Submission 042027-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4744 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location121193281-121271407 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 121211313 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 1254 (V1254D)
Ref Sequence ENSEMBL: ENSMUSP00000106278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110647] [ENSMUST00000110648] [ENSMUST00000131245] [ENSMUST00000154426]
Predicted Effect probably damaging
Transcript: ENSMUST00000110647
AA Change: V1254D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106277
Gene: ENSMUSG00000043909
AA Change: V1254D

DomainStartEndE-ValueType
low complexity region 136 149 N/A INTRINSIC
low complexity region 158 169 N/A INTRINSIC
low complexity region 647 661 N/A INTRINSIC
low complexity region 1031 1042 N/A INTRINSIC
low complexity region 1099 1112 N/A INTRINSIC
low complexity region 1260 1272 N/A INTRINSIC
low complexity region 1290 1332 N/A INTRINSIC
Pfam:53-BP1_Tudor 1430 1551 2.5e-80 PFAM
low complexity region 1581 1601 N/A INTRINSIC
BRCT 1673 1785 7.13e-1 SMART
BRCT 1813 1901 1.03e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110648
AA Change: V1254D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106278
Gene: ENSMUSG00000043909
AA Change: V1254D

DomainStartEndE-ValueType
low complexity region 136 149 N/A INTRINSIC
low complexity region 158 169 N/A INTRINSIC
low complexity region 647 661 N/A INTRINSIC
low complexity region 1031 1042 N/A INTRINSIC
low complexity region 1099 1112 N/A INTRINSIC
low complexity region 1260 1272 N/A INTRINSIC
low complexity region 1290 1332 N/A INTRINSIC
low complexity region 1389 1409 N/A INTRINSIC
Pfam:53-BP1_Tudor 1480 1601 1.5e-80 PFAM
low complexity region 1631 1651 N/A INTRINSIC
BRCT 1723 1835 7.13e-1 SMART
BRCT 1863 1951 1.03e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124411
Predicted Effect probably benign
Transcript: ENSMUST00000124554
Predicted Effect probably benign
Transcript: ENSMUST00000131245
SMART Domains Protein: ENSMUSP00000114457
Gene: ENSMUSG00000043909

DomainStartEndE-ValueType
low complexity region 136 149 N/A INTRINSIC
low complexity region 158 169 N/A INTRINSIC
low complexity region 647 661 N/A INTRINSIC
low complexity region 991 1002 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135890
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140582
Predicted Effect probably benign
Transcript: ENSMUST00000147540
Predicted Effect probably benign
Transcript: ENSMUST00000154426
SMART Domains Protein: ENSMUSP00000117548
Gene: ENSMUSG00000043909

DomainStartEndE-ValueType
Pfam:53-BP1_Tudor 1 70 2.5e-44 PFAM
low complexity region 100 120 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156493
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 99% (82/83)
MGI Phenotype PHENOTYPE: Homozygous mutations in this gene result in growth retardation, immunodeficiency, thymic hypoplasia, and increased incidence of thymic lymphomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik T C 5: 114,879,556 S143P possibly damaging Het
4933427D14Rik T C 11: 72,175,539 K614E probably damaging Het
Aatk A G 11: 120,016,122 M155T possibly damaging Het
Acvr2b T C 9: 119,431,262 L333P probably damaging Het
Adam22 T C 5: 8,078,699 E865G probably damaging Het
Add2 A G 6: 86,110,888 S358G probably damaging Het
Agap2 T C 10: 127,090,203 probably null Het
Alkbh8 G A 9: 3,344,604 W49* probably null Het
AU015228 A T 2: 130,100,629 noncoding transcript Het
Bank1 G T 3: 136,247,689 R102S probably benign Het
Brap T A 5: 121,662,130 D27E probably damaging Het
Cyb5r2 G T 7: 107,750,277 H276N possibly damaging Het
Dhh A G 15: 98,894,258 F290L possibly damaging Het
Dhrs7 T A 12: 72,652,251 N319I possibly damaging Het
Ebpl A G 14: 61,360,233 V53A probably damaging Het
Eif3j2 TGCCGCCGCCGCCGCCGCCGCCGCCGCC TGCCGCCGCCGCCGCCGCCGCCGCC 18: 43,477,717 probably benign Het
Etnk1 A C 6: 143,186,593 N220T probably damaging Het
F11r T A 1: 171,460,598 V64D probably benign Het
Fam171a1 T C 2: 3,224,909 S360P probably damaging Het
Fignl1 A G 11: 11,801,585 M490T probably damaging Het
Fpr-rs7 A T 17: 20,114,003 M75K probably benign Het
Fzd7 T A 1: 59,484,436 F493I possibly damaging Het
Galnt14 G T 17: 73,507,833 P412T probably damaging Het
Gcg T A 2: 62,478,631 S60C probably damaging Het
Ggt1 A G 10: 75,585,899 K527E probably benign Het
Gm14085 A T 2: 122,522,805 K489* probably null Het
Gm16551 T A 9: 74,850,871 noncoding transcript Het
Gm9972 A G 11: 43,036,690 K55E unknown Het
Gpr141 T A 13: 19,751,714 D297V probably benign Het
Grin2b G A 6: 135,778,699 S539L probably damaging Het
Hhipl1 A T 12: 108,319,979 N515I possibly damaging Het
Hmcn1 T G 1: 150,577,612 E5317D probably damaging Het
Hsf5 T A 11: 87,622,791 N227K probably benign Het
Igfn1 A T 1: 135,982,458 D129E probably benign Het
Invs T C 4: 48,397,609 F339L probably damaging Het
Jak2 T A 19: 29,262,256 S17T probably benign Het
Mdga2 T A 12: 66,797,727 I166F probably benign Het
Nck1 T C 9: 100,506,744 I6V probably benign Het
Neb T C 2: 52,150,577 D6624G probably benign Het
Nmur2 A G 11: 56,040,835 Y17H probably benign Het
Nwd2 T C 5: 63,806,967 L1298P probably damaging Het
Ocel1 A G 8: 71,372,753 E161G probably damaging Het
Olfr345 A T 2: 36,640,979 probably null Het
Pabpc2 A G 18: 39,774,828 Y382C probably benign Het
Panx1 A G 9: 15,010,298 probably benign Het
Pdhx A T 2: 103,042,296 V147D probably benign Het
Pigz A T 16: 31,945,333 H403L probably damaging Het
Pilra T C 5: 137,835,507 probably null Het
Rbm47 T C 5: 66,026,693 D189G probably damaging Het
Rhobtb2 A G 14: 69,794,002 L558P probably damaging Het
Scarf2 G A 16: 17,803,516 R322H probably damaging Het
Sept3 T C 15: 82,290,457 probably null Het
Sirt2 T C 7: 28,777,013 F26L probably damaging Het
Slc1a1 A T 19: 28,894,525 T133S probably benign Het
Slc1a2 A G 2: 102,737,869 I84V probably benign Het
Slc6a9 A T 4: 117,867,895 Q562L probably benign Het
Snx29 C T 16: 11,349,909 Q25* probably null Het
St6galnac6 A G 2: 32,618,543 I231V probably damaging Het
Stard9 A G 2: 120,696,123 T954A probably benign Het
Sufu A G 19: 46,483,630 M443V possibly damaging Het
Sv2b T C 7: 75,206,518 D8G probably benign Het
Tapbpl G A 6: 125,228,285 R233W probably damaging Het
Tex10 A G 4: 48,469,990 L25S probably benign Het
Ugt3a1 T A 15: 9,310,553 I307N probably benign Het
Unc13c T C 9: 73,931,844 D575G probably damaging Het
Usf2 A T 7: 30,954,772 D166E probably damaging Het
Usp25 T A 16: 77,114,989 L969M probably damaging Het
Usp32 G A 11: 84,994,393 P1276L probably damaging Het
Vmn2r8 T A 5: 108,808,581 E58D probably benign Het
Zfp462 G T 4: 55,011,598 C40F probably damaging Het
Other mutations in Trp53bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Trp53bp1 APN 2 121256579 missense possibly damaging 0.69
IGL00690:Trp53bp1 APN 2 121235995 missense probably damaging 1.00
IGL00922:Trp53bp1 APN 2 121208482 missense probably damaging 0.96
IGL01475:Trp53bp1 APN 2 121270319 splice site probably null
IGL01639:Trp53bp1 APN 2 121202692 missense possibly damaging 0.51
IGL01662:Trp53bp1 APN 2 121236025 missense probably damaging 1.00
IGL01757:Trp53bp1 APN 2 121211304 missense probably damaging 0.99
IGL01829:Trp53bp1 APN 2 121215896 missense probably benign 0.39
IGL02247:Trp53bp1 APN 2 121236589 missense probably damaging 1.00
IGL02349:Trp53bp1 APN 2 121199074 missense probably damaging 1.00
IGL02391:Trp53bp1 APN 2 121202710 missense possibly damaging 0.67
chives UTSW 2 121251868 missense probably null 0.13
concur UTSW 2 121270319 splice site probably null
confirmation UTSW 2 121205113 critical splice acceptor site probably null
Infra UTSW 2 121247499 critical splice donor site probably null
Legume UTSW 2 121199042 missense probably damaging 0.99
lentil UTSW 2 121251868 missense probably null 0.13
lentil2 UTSW 2 121207887 missense probably damaging 1.00
Profundus UTSW 2 121207803 missense probably damaging 1.00
split_pea UTSW 2 121228606 nonsense probably null
verily UTSW 2 121211313 missense probably damaging 1.00
PIT1430001:Trp53bp1 UTSW 2 121271275 missense probably damaging 1.00
R0045:Trp53bp1 UTSW 2 121204497 missense probably benign
R0060:Trp53bp1 UTSW 2 121204525 missense probably damaging 1.00
R0060:Trp53bp1 UTSW 2 121204525 missense probably damaging 1.00
R0103:Trp53bp1 UTSW 2 121236759 missense possibly damaging 0.92
R0103:Trp53bp1 UTSW 2 121236759 missense possibly damaging 0.92
R0281:Trp53bp1 UTSW 2 121270237 missense probably damaging 1.00
R0386:Trp53bp1 UTSW 2 121204943 missense probably damaging 1.00
R0427:Trp53bp1 UTSW 2 121236017 missense probably damaging 1.00
R0505:Trp53bp1 UTSW 2 121269969 missense probably damaging 0.99
R0522:Trp53bp1 UTSW 2 121251868 missense probably null 0.13
R0523:Trp53bp1 UTSW 2 121251868 missense probably null 0.13
R0525:Trp53bp1 UTSW 2 121251868 missense probably null 0.13
R0543:Trp53bp1 UTSW 2 121251868 missense probably null 0.13
R0559:Trp53bp1 UTSW 2 121227801 missense probably damaging 1.00
R0573:Trp53bp1 UTSW 2 121228172 splice site probably benign
R0593:Trp53bp1 UTSW 2 121270528 missense possibly damaging 0.95
R0648:Trp53bp1 UTSW 2 121235707 missense probably benign 0.20
R0680:Trp53bp1 UTSW 2 121251868 missense probably null 0.13
R0732:Trp53bp1 UTSW 2 121248264 missense probably null 0.96
R0905:Trp53bp1 UTSW 2 121204318 splice site probably benign
R1377:Trp53bp1 UTSW 2 121270642 missense probably damaging 1.00
R1415:Trp53bp1 UTSW 2 121236184 missense probably damaging 1.00
R1725:Trp53bp1 UTSW 2 121252000 missense possibly damaging 0.46
R1971:Trp53bp1 UTSW 2 121205036 missense probably damaging 1.00
R2045:Trp53bp1 UTSW 2 121204483 missense probably benign
R2143:Trp53bp1 UTSW 2 121216064 missense probably benign 0.00
R2282:Trp53bp1 UTSW 2 121270273 nonsense probably null
R2296:Trp53bp1 UTSW 2 121209247 missense possibly damaging 0.96
R3106:Trp53bp1 UTSW 2 121236652 missense probably damaging 1.00
R3792:Trp53bp1 UTSW 2 121200329 missense probably damaging 1.00
R3793:Trp53bp1 UTSW 2 121200329 missense probably damaging 1.00
R3946:Trp53bp1 UTSW 2 121228626 missense probably damaging 0.99
R4001:Trp53bp1 UTSW 2 121205085 missense probably damaging 1.00
R4327:Trp53bp1 UTSW 2 121256650 missense probably damaging 1.00
R4585:Trp53bp1 UTSW 2 121207951 missense probably damaging 1.00
R4630:Trp53bp1 UTSW 2 121207887 missense probably damaging 1.00
R4751:Trp53bp1 UTSW 2 121227809 missense probably damaging 1.00
R4754:Trp53bp1 UTSW 2 121207879 missense probably damaging 1.00
R4755:Trp53bp1 UTSW 2 121228606 nonsense probably null
R4850:Trp53bp1 UTSW 2 121205113 critical splice acceptor site probably null
R4870:Trp53bp1 UTSW 2 121256641 missense probably damaging 1.00
R4879:Trp53bp1 UTSW 2 121202603 missense probably damaging 0.99
R4924:Trp53bp1 UTSW 2 121221220 nonsense probably null
R4962:Trp53bp1 UTSW 2 121270546 missense probably benign 0.12
R5019:Trp53bp1 UTSW 2 121270319 splice site probably null
R5111:Trp53bp1 UTSW 2 121211387 missense probably damaging 0.99
R5149:Trp53bp1 UTSW 2 121216117 missense probably benign 0.00
R5252:Trp53bp1 UTSW 2 121243983 missense probably benign 0.40
R5533:Trp53bp1 UTSW 2 121207746 missense probably damaging 1.00
R5642:Trp53bp1 UTSW 2 121236662 missense probably benign 0.00
R5773:Trp53bp1 UTSW 2 121243914 missense probably damaging 1.00
R5819:Trp53bp1 UTSW 2 121208392 nonsense probably null
R5886:Trp53bp1 UTSW 2 121205021 missense probably damaging 1.00
R5908:Trp53bp1 UTSW 2 121236823 missense probably benign 0.06
R6012:Trp53bp1 UTSW 2 121256602 missense probably benign 0.07
R6351:Trp53bp1 UTSW 2 121269945 missense probably damaging 1.00
R6406:Trp53bp1 UTSW 2 121270612 missense probably damaging 0.99
R6575:Trp53bp1 UTSW 2 121228603 missense probably damaging 1.00
R6619:Trp53bp1 UTSW 2 121247499 critical splice donor site probably null
R6626:Trp53bp1 UTSW 2 121207803 missense probably damaging 1.00
R6754:Trp53bp1 UTSW 2 121270576 missense possibly damaging 0.83
R6765:Trp53bp1 UTSW 2 121209309 missense probably damaging 1.00
R6806:Trp53bp1 UTSW 2 121228666 missense probably damaging 0.99
R6860:Trp53bp1 UTSW 2 121199113 missense probably damaging 1.00
R6991:Trp53bp1 UTSW 2 121208040 missense probably damaging 1.00
R7278:Trp53bp1 UTSW 2 121199035 missense probably damaging 1.00
R7339:Trp53bp1 UTSW 2 121236469 missense probably benign 0.00
R7357:Trp53bp1 UTSW 2 121211300 missense probably damaging 1.00
R7477:Trp53bp1 UTSW 2 121236346 missense probably benign 0.34
R7577:Trp53bp1 UTSW 2 121236638 missense possibly damaging 0.65
R7643:Trp53bp1 UTSW 2 121247814 splice site probably null
R7728:Trp53bp1 UTSW 2 121207899 missense probably damaging 1.00
R7806:Trp53bp1 UTSW 2 121205061 missense probably damaging 0.99
R7955:Trp53bp1 UTSW 2 121235744 missense possibly damaging 0.59
R8099:Trp53bp1 UTSW 2 121199749 missense probably damaging 1.00
R8200:Trp53bp1 UTSW 2 121236176 missense probably benign 0.00
R8282:Trp53bp1 UTSW 2 121199042 missense probably damaging 0.99
RF046:Trp53bp1 UTSW 2 121216001 frame shift probably null
Z1088:Trp53bp1 UTSW 2 121253645 missense probably benign 0.04
Z1177:Trp53bp1 UTSW 2 121244060 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- ACACACCAGTTAAGAAGCTTGAG -3'
(R):5'- TCCCAGTGAAAACTGTGACTC -3'

Sequencing Primer
(F):5'- TGGTCTACAGAGTAAGTTCCAGGAC -3'
(R):5'- GTGAAAACTGTGACTCTATTCCACC -3'
Posted On2015-11-11