Mutagenetix > Incidental Mutation

Incidental Mutation 'R0403:Tpr'

35656

Institutional Source

Beutler Lab

Gene Symbol

Tpr

Ensembl Gene

ENSMUSG00000006005

Gene Name

translocated promoter region, nuclear basket protein

Synonyms

2610029M07Rik

MMRRC Submission

038608-MU

Accession Numbers

Genbank: NM_133780; MGI: 1922066

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0403 (G1)

Quality Score

163

Status

Validated

Chromosome

Chromosomal Location

150392838-150449935 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

G to A at 150407414 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000117616 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000119161] [ENSMUST00000124973]

AlphaFold

F6ZDS4

Predicted Effect

probably benign
Transcript: ENSMUST00000119161

SMART Domains

Protein: ENSMUSP00000112606
Gene: ENSMUSG00000006005

Domain	Start	End	E-Value	Type
coiled coil region	49	370	N/A	INTRINSIC
coiled coil region	423	515	N/A	INTRINSIC
low complexity region	518	534	N/A	INTRINSIC
coiled coil region	539	604	N/A	INTRINSIC
low complexity region	690	703	N/A	INTRINSIC
low complexity region	782	795	N/A	INTRINSIC
low complexity region	811	826	N/A	INTRINSIC
low complexity region	1003	1019	N/A	INTRINSIC
Pfam:TPR_MLP1_2	1036	1167	9.1e-33	PFAM
coiled coil region	1215	1421	N/A	INTRINSIC
coiled coil region	1473	1629	N/A	INTRINSIC
internal_repeat_3	1630	1691	1.48e-5	PROSPERO
low complexity region	1695	1717	N/A	INTRINSIC
low complexity region	1761	1777	N/A	INTRINSIC
internal_repeat_5	1814	1827	5.58e-5	PROSPERO
internal_repeat_3	1819	1881	1.48e-5	PROSPERO
internal_repeat_4	1875	1895	5.58e-5	PROSPERO
internal_repeat_1	1893	1919	2.03e-6	PROSPERO
low complexity region	1920	1933	N/A	INTRINSIC
low complexity region	1942	1981	N/A	INTRINSIC
low complexity region	1989	2014	N/A	INTRINSIC
internal_repeat_4	2017	2036	5.58e-5	PROSPERO
low complexity region	2059	2078	N/A	INTRINSIC
internal_repeat_2	2084	2135	3.95e-6	PROSPERO
internal_repeat_5	2127	2140	5.58e-5	PROSPERO
internal_repeat_1	2154	2179	2.03e-6	PROSPERO
internal_repeat_2	2156	2212	3.95e-6	PROSPERO
low complexity region	2239	2251	N/A	INTRINSIC
low complexity region	2263	2277	N/A	INTRINSIC
low complexity region	2292	2314	N/A	INTRINSIC
low complexity region	2346	2357	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124973

SMART Domains

Protein: ENSMUSP00000117616
Gene: ENSMUSG00000006005

Domain	Start	End	E-Value	Type
low complexity region	3	14	N/A	INTRINSIC
low complexity region	24	77	N/A	INTRINSIC
coiled coil region	123	444	N/A	INTRINSIC
coiled coil region	497	589	N/A	INTRINSIC
low complexity region	592	608	N/A	INTRINSIC
coiled coil region	613	678	N/A	INTRINSIC
low complexity region	764	777	N/A	INTRINSIC
low complexity region	856	869	N/A	INTRINSIC
low complexity region	885	900	N/A	INTRINSIC
low complexity region	1077	1093	N/A	INTRINSIC
Pfam:TPR_MLP1_2	1112	1240	5.1e-37	PFAM
coiled coil region	1289	1495	N/A	INTRINSIC
low complexity region	1682	1698	N/A	INTRINSIC
internal_repeat_5	1703	1750	8.04e-5	PROSPERO
internal_repeat_3	1704	1765	1.07e-5	PROSPERO
low complexity region	1769	1791	N/A	INTRINSIC
low complexity region	1835	1851	N/A	INTRINSIC
internal_repeat_5	1857	1900	8.04e-5	PROSPERO
internal_repeat_6	1887	1911	8.04e-5	PROSPERO
internal_repeat_3	1893	1955	1.07e-5	PROSPERO
internal_repeat_4	1949	1969	4.1e-5	PROSPERO
internal_repeat_1	1967	1993	1.42e-6	PROSPERO
low complexity region	1994	2007	N/A	INTRINSIC
low complexity region	2016	2055	N/A	INTRINSIC
low complexity region	2063	2088	N/A	INTRINSIC
internal_repeat_4	2091	2110	4.1e-5	PROSPERO
internal_repeat_6	2108	2132	8.04e-5	PROSPERO
low complexity region	2133	2152	N/A	INTRINSIC
internal_repeat_2	2158	2209	2.78e-6	PROSPERO
internal_repeat_1	2228	2253	1.42e-6	PROSPERO
internal_repeat_2	2230	2286	2.78e-6	PROSPERO
low complexity region	2313	2325	N/A	INTRINSIC
low complexity region	2337	2351	N/A	INTRINSIC
low complexity region	2366	2388	N/A	INTRINSIC
low complexity region	2420	2431	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141827

Coding Region Coverage

1x: 98.0%
3x: 96.8%
10x: 93.2%
20x: 83.7%

Validation Efficiency

97% (110/113)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large coiled-coil protein that forms intranuclear filaments attached to the inner surface of nuclear pore complexes (NPCs). The protein directly interacts with several components of the NPC. It is required for the nuclear export of mRNAs and some proteins. Oncogenic fusions of the 5' end of this gene with several different kinase genes occur in some neoplasias. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(28) : Targeted, other(2) Gene trapped(26)

Other mutations in this stock

Total: 105 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ace	A	G	11: 105,973,880		probably null	Het
Adgrg3	C	T	8: 95,036,922	L284F	probably benign	Het
Alkbh8	T	A	9: 3,385,469	V587E	probably damaging	Het
Ap4b1	T	A	3: 103,818,839	C244S	probably damaging	Het
Ap4b1	T	A	3: 103,821,396	M590K	probably benign	Het
Arhgap15	C	T	2: 44,063,766	T168I	probably damaging	Het
Arntl2	T	A	6: 146,822,655	H348Q	probably damaging	Het
Atp8b1	A	G	18: 64,540,310	V997A	probably damaging	Het
Atrn	G	A	2: 130,906,859	C100Y	probably damaging	Het
Baiap2l2	C	A	15: 79,271,216	A151S	probably benign	Het
Baz2b	A	T	2: 59,969,377	D199E	possibly damaging	Het
Cblb	A	G	16: 52,152,626	D440G	probably benign	Het
Cdon	T	C	9: 35,473,500	V694A	probably benign	Het
Cep250	A	T	2: 155,992,349	R2065W	probably damaging	Het
Ces2b	G	T	8: 104,833,945	A131S	probably damaging	Het
Chrna9	A	T	5: 65,967,892	T59S	possibly damaging	Het
Cog3	T	A	14: 75,742,327		probably benign	Het
Cpa1	G	A	6: 30,641,857	V227I	probably benign	Het
Cyp3a25	A	T	5: 145,998,513	C98S	probably damaging	Het
D8Ertd738e	C	T	8: 84,249,601		probably null	Het
Ddx60	A	G	8: 61,994,541		probably benign	Het
Dhx16	T	C	17: 35,883,050		probably null	Het
Dnah9	T	A	11: 66,084,789	Q1478L	possibly damaging	Het
Dock10	T	C	1: 80,524,070	Y1434C	possibly damaging	Het
Enpp3	T	A	10: 24,804,436	D325V	probably damaging	Het
Entpd6	C	A	2: 150,760,170	T194K	possibly damaging	Het
Fam208b	A	T	13: 3,582,052	Y816*	probably null	Het
Fat2	A	T	11: 55,270,349	V3185E	probably benign	Het
Flrt1	A	G	19: 7,095,919	L421P	probably benign	Het
Fmn2	A	T	1: 174,694,278	Q1292L	probably damaging	Het
Fndc1	T	C	17: 7,775,588		probably null	Het
Fndc1	T	C	17: 7,753,723	D1459G	probably damaging	Het
Fzr1	A	G	10: 81,369,368	S265P	possibly damaging	Het
Gm13119	A	G	4: 144,362,646	N178S	probably benign	Het
Gm14085	T	C	2: 122,521,854	L364S	probably damaging	Het
Gpr142	G	A	11: 114,806,029	V134M	probably damaging	Het
Grid2ip	G	T	5: 143,357,620	V24L	possibly damaging	Het
Herc2	G	A	7: 56,159,417	R2555H	probably damaging	Het
Hpdl	A	T	4: 116,820,479	Y262N	possibly damaging	Het
Htr3a	A	G	9: 48,908,659	V57A	probably damaging	Het
Igfbp7	T	C	5: 77,355,591	I186V	probably benign	Het
Itga2b	C	T	11: 102,467,326		probably null	Het
Itgae	A	C	11: 73,123,183	D736A	possibly damaging	Het
Itpkc	T	A	7: 27,208,345	M645L	probably benign	Het
Jchain	T	C	5: 88,521,378	R139G	probably benign	Het
Kif13a	A	G	13: 46,791,401	V908A	probably damaging	Het
Kif1b	T	A	4: 149,181,967	K389*	probably null	Het
Klhl12	T	C	1: 134,485,856	Y360H	possibly damaging	Het
Knop1	G	A	7: 118,853,053	R148W	probably damaging	Het
Lpar1	T	A	4: 58,487,191	N27Y	probably damaging	Het
Lpar2	T	A	8: 69,824,152	V197D	probably damaging	Het
Lrrc74a	A	G	12: 86,740,979	N128S	probably damaging	Het
Lum	G	T	10: 97,572,043	V337F	probably benign	Het
Mag	T	C	7: 30,906,980	D344G	probably damaging	Het
Maip1	G	A	1: 57,407,196	A142T	probably benign	Het
Mlh3	A	G	12: 85,268,968	V148A	possibly damaging	Het
Nav3	A	G	10: 109,767,103	V1195A	probably damaging	Het
Ncor2	A	G	5: 125,033,337	S868P	possibly damaging	Het
Nek1	A	G	8: 61,106,855	E907G	probably damaging	Het
Nfam1	G	A	15: 83,016,379	T134I	probably benign	Het
Nr0b2	T	C	4: 133,553,759	V112A	probably damaging	Het
Nrp1	A	G	8: 128,457,969	N365S	probably damaging	Het
Nrsn2	T	C	2: 152,369,790	Y107C	probably damaging	Het
Ntng1	G	A	3: 109,934,611	A282V	probably damaging	Het
Nxf1	T	C	19: 8,765,028	I337T	probably damaging	Het
Obscn	C	T	11: 59,076,540	G479D	probably damaging	Het
Olfr45	T	C	7: 140,691,309	S135P	possibly damaging	Het
Oprd1	T	A	4: 132,113,768	D293V	probably benign	Het
P3h2	T	G	16: 25,969,950	N586H	possibly damaging	Het
Pcid2	T	C	8: 13,085,367	Y214C	probably damaging	Het
Pkd1l3	C	G	8: 109,623,649	D375E	possibly damaging	Het
Pkd1l3	G	A	8: 109,623,663	S380N	probably benign	Het
Ppic	C	A	18: 53,411,071	G81W	probably damaging	Het
Ppp2r1a	C	A	17: 20,957,041	P246T	probably damaging	Het
Ppp4r4	T	G	12: 103,584,102	S46A	probably benign	Het
Prkce	A	G	17: 86,168,653	T21A	probably damaging	Het
Prkg2	T	C	5: 98,994,645	E210G	possibly damaging	Het
Prss35	A	G	9: 86,756,037	M287V	probably damaging	Het
Psd	G	A	19: 46,320,972		probably benign	Het
Ptch2	A	T	4: 117,110,839	K843*	probably null	Het
Rab44	C	A	17: 29,145,261	T603K	probably damaging	Het
Rasal3	T	A	17: 32,392,790		probably null	Het
Rbbp6	A	G	7: 122,992,296	T526A	probably damaging	Het
Ros1	A	T	10: 52,143,438		probably benign	Het
Sec24b	T	A	3: 129,989,676	L1104F	possibly damaging	Het
Sec24b	A	G	3: 129,999,534	S685P	probably damaging	Het
Sema6a	G	A	18: 47,290,045		probably null	Het
Setmar	A	T	6: 108,075,962	H139L	probably benign	Het
Slc4a7	T	C	14: 14,766,808	V710A	probably benign	Het
Smarcc1	T	A	9: 110,237,808		probably null	Het
Smchd1	G	A	17: 71,394,902	L1032F	probably damaging	Het
Speg	T	C	1: 75,430,784		probably benign	Het
Tcea1	C	G	1: 4,889,503	R134G	probably benign	Het
Tchhl1	C	T	3: 93,471,029	Q347*	probably null	Het
Tecrl	A	T	5: 83,354,758		probably benign	Het
Tepsin	T	C	11: 120,093,682		probably benign	Het
Tmem40	G	A	6: 115,733,985		probably benign	Het
Ttll12	A	T	15: 83,580,658		probably benign	Het
Ttn	T	A	2: 76,909,608	D3529V	probably benign	Het
Usp34	T	A	11: 23,333,838	H177Q	possibly damaging	Het
Vsig10	T	A	5: 117,338,461	S327T	probably benign	Het
Zbtb4	T	A	11: 69,777,639	M396K	probably damaging	Het
Zfp352	C	T	4: 90,225,009	T462I	possibly damaging	Het
Zfp385b	T	C	2: 77,476,845	M145V	probably damaging	Het
Zfp780b	C	A	7: 27,971,689	V65F	possibly damaging	Het

Other mutations in Tpr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00327:Tpr	APN	1	150423696	splice site	probably benign
IGL00424:Tpr	APN	1	150398595	splice site	probably benign
IGL01095:Tpr	APN	1	150410140	missense	possibly damaging	0.95
IGL01347:Tpr	APN	1	150426987	missense	probably damaging	1.00
IGL01519:Tpr	APN	1	150431168	missense	probably benign	0.01
IGL01768:Tpr	APN	1	150444448	missense	possibly damaging	0.85
IGL01939:Tpr	APN	1	150413745	missense	possibly damaging	0.82
IGL01988:Tpr	APN	1	150426999	splice site	probably null
IGL02065:Tpr	APN	1	150413774	missense	probably benign	0.13
IGL02110:Tpr	APN	1	150435742	missense	probably damaging	0.97
IGL02311:Tpr	APN	1	150398653	missense	probably damaging	0.97
IGL02454:Tpr	APN	1	150431192	missense	probably benign	0.00
IGL02569:Tpr	APN	1	150425631	unclassified	probably benign
IGL03168:Tpr	APN	1	150408757	missense	probably benign	0.04
IGL03193:Tpr	APN	1	150440080	missense	possibly damaging	0.85
IGL03333:Tpr	APN	1	150426967	missense	probably benign	0.04
gridiron	UTSW	1	150423516	missense	probably damaging	1.00
Pouch	UTSW	1	150433772	missense	probably damaging	1.00
punt	UTSW	1	150418039	missense	probably benign	0.02
Turf	UTSW	1	150442245	critical splice donor site	probably null
F6893:Tpr	UTSW	1	150393562	missense	possibly damaging	0.84
PIT4305001:Tpr	UTSW	1	150440137	missense	possibly damaging	0.85
PIT4469001:Tpr	UTSW	1	150403956	missense	probably benign	0.41
R0085:Tpr	UTSW	1	150417413	missense	possibly damaging	0.95
R0101:Tpr	UTSW	1	150409302	splice site	probably benign
R0116:Tpr	UTSW	1	150410147	missense	probably damaging	0.98
R0136:Tpr	UTSW	1	150430595	missense	probably benign	0.01
R0207:Tpr	UTSW	1	150417427	missense	possibly damaging	0.74
R0219:Tpr	UTSW	1	150443258	splice site	probably null
R0380:Tpr	UTSW	1	150412947	missense	probably benign	0.27
R0469:Tpr	UTSW	1	150423667	frame shift	probably null
R0480:Tpr	UTSW	1	150428241	missense	possibly damaging	0.83
R0514:Tpr	UTSW	1	150402273	missense	possibly damaging	0.55
R0563:Tpr	UTSW	1	150408858	missense	probably benign	0.13
R0631:Tpr	UTSW	1	150422531	missense	probably damaging	0.98
R0685:Tpr	UTSW	1	150433725	missense	possibly damaging	0.69
R0730:Tpr	UTSW	1	150393407	utr 5 prime	probably benign
R0739:Tpr	UTSW	1	150407497	missense	possibly damaging	0.94
R0780:Tpr	UTSW	1	150431341	missense	probably benign	0.00
R1018:Tpr	UTSW	1	150442183	missense	possibly damaging	0.53
R1084:Tpr	UTSW	1	150442161	missense	probably benign	0.18
R1532:Tpr	UTSW	1	150418000	missense	probably damaging	0.99
R1551:Tpr	UTSW	1	150436801	missense	probably benign	0.00
R1608:Tpr	UTSW	1	150426893	missense	probably damaging	0.96
R1759:Tpr	UTSW	1	150429524	missense	probably benign	0.19
R1817:Tpr	UTSW	1	150419903	missense	probably damaging	0.98
R1932:Tpr	UTSW	1	150421663	missense	probably benign	0.00
R1978:Tpr	UTSW	1	150419907	missense	possibly damaging	0.65
R2031:Tpr	UTSW	1	150442119	missense	probably benign
R2176:Tpr	UTSW	1	150419940	missense	possibly damaging	0.56
R2235:Tpr	UTSW	1	150442092	missense	probably benign	0.33
R2339:Tpr	UTSW	1	150413774	missense	probably benign	0.01
R2367:Tpr	UTSW	1	150433728	missense	probably damaging	0.99
R2507:Tpr	UTSW	1	150392944	start codon destroyed	probably null
R3931:Tpr	UTSW	1	150435904	missense	probably damaging	1.00
R4320:Tpr	UTSW	1	150423574	missense	possibly damaging	0.96
R4439:Tpr	UTSW	1	150403961	missense	probably benign	0.01
R4568:Tpr	UTSW	1	150392959	unclassified	probably benign
R4644:Tpr	UTSW	1	150423499	missense	probably benign	0.01
R4665:Tpr	UTSW	1	150444399	missense	probably damaging	0.97
R4672:Tpr	UTSW	1	150423567	missense	probably benign	0.45
R4673:Tpr	UTSW	1	150423567	missense	probably benign	0.45
R4735:Tpr	UTSW	1	150442196	missense	possibly damaging	0.91
R4767:Tpr	UTSW	1	150430529	intron	probably benign
R4772:Tpr	UTSW	1	150413113	missense	possibly damaging	0.46
R4815:Tpr	UTSW	1	150398608	missense	probably benign	0.01
R4839:Tpr	UTSW	1	150449197	nonsense	probably null
R4844:Tpr	UTSW	1	150445879	missense	possibly damaging	0.86
R4925:Tpr	UTSW	1	150432565	missense	probably benign	0.00
R4967:Tpr	UTSW	1	150410059	missense	probably damaging	0.99
R5017:Tpr	UTSW	1	150398637	missense	probably benign	0.00
R5096:Tpr	UTSW	1	150446202	missense	probably damaging	0.99
R5353:Tpr	UTSW	1	150445924	missense	probably damaging	1.00
R5354:Tpr	UTSW	1	150445924	missense	probably damaging	1.00
R5484:Tpr	UTSW	1	150426888	missense	probably benign	0.33
R5601:Tpr	UTSW	1	150435853	missense	possibly damaging	0.75
R5642:Tpr	UTSW	1	150423818	missense	probably damaging	0.99
R5779:Tpr	UTSW	1	150423541	missense	probably damaging	1.00
R5787:Tpr	UTSW	1	150395286	missense	probably benign	0.01
R5892:Tpr	UTSW	1	150407400	missense	probably benign	0.44
R5915:Tpr	UTSW	1	150425649	missense	probably benign	0.15
R5928:Tpr	UTSW	1	150428127	missense	probably benign	0.30
R6146:Tpr	UTSW	1	150423162	missense	possibly damaging	0.83
R6154:Tpr	UTSW	1	150423816	missense	probably benign	0.00
R6234:Tpr	UTSW	1	150418039	missense	probably benign	0.02
R6263:Tpr	UTSW	1	150442245	critical splice donor site	probably null
R6318:Tpr	UTSW	1	150445888	missense	possibly damaging	0.93
R6550:Tpr	UTSW	1	150423977	missense	probably damaging	1.00
R6592:Tpr	UTSW	1	150411905	missense	possibly damaging	0.83
R6704:Tpr	UTSW	1	150406508	missense	possibly damaging	0.80
R6716:Tpr	UTSW	1	150414765	missense	probably damaging	1.00
R6836:Tpr	UTSW	1	150436673	splice site	probably null
R6886:Tpr	UTSW	1	150423965	missense	probably benign	0.00
R6894:Tpr	UTSW	1	150436847	missense	probably benign	0.28
R6928:Tpr	UTSW	1	150408785	missense	possibly damaging	0.83
R7011:Tpr	UTSW	1	150433772	missense	probably damaging	1.00
R7034:Tpr	UTSW	1	150423607	missense	probably benign	0.02
R7036:Tpr	UTSW	1	150423607	missense	probably benign	0.02
R7183:Tpr	UTSW	1	150406551	missense	probably damaging	1.00
R7221:Tpr	UTSW	1	150446178	missense	possibly damaging	0.96
R7223:Tpr	UTSW	1	150439256	missense	possibly damaging	0.53
R7294:Tpr	UTSW	1	150403887	missense	probably damaging	1.00
R7343:Tpr	UTSW	1	150393494	missense	unknown
R7361:Tpr	UTSW	1	150447621	missense	possibly damaging	0.73
R7405:Tpr	UTSW	1	150442127	missense	probably benign	0.02
R7637:Tpr	UTSW	1	150423516	missense	probably damaging	1.00
R7720:Tpr	UTSW	1	150429532	missense	possibly damaging	0.49
R7721:Tpr	UTSW	1	150444429	missense	probably benign
R7751:Tpr	UTSW	1	150419895	missense	probably benign	0.17
R7804:Tpr	UTSW	1	150432559	missense	probably damaging	0.99
R7878:Tpr	UTSW	1	150423660	missense	possibly damaging	0.67
R7973:Tpr	UTSW	1	150403887	missense	probably damaging	1.00
R8013:Tpr	UTSW	1	150398608	missense	probably benign
R8220:Tpr	UTSW	1	150432413	missense	probably benign	0.05
R8274:Tpr	UTSW	1	150423479	splice site	probably benign
R8428:Tpr	UTSW	1	150414813	missense	probably damaging	1.00
R8482:Tpr	UTSW	1	150433700	missense	probably damaging	1.00
R8699:Tpr	UTSW	1	150418021	missense	probably damaging	0.99
R8859:Tpr	UTSW	1	150408846	missense	possibly damaging	0.90
R9119:Tpr	UTSW	1	150404002	missense	probably damaging	0.99
R9326:Tpr	UTSW	1	150425656	missense	possibly damaging	0.86
R9618:Tpr	UTSW	1	150446228	missense	possibly damaging	0.70
R9680:Tpr	UTSW	1	150439136	missense	probably benign	0.32
R9776:Tpr	UTSW	1	150449188	missense	probably benign	0.00
X0021:Tpr	UTSW	1	150395207	missense	probably damaging	1.00
Z1177:Tpr	UTSW	1	150428235	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACTAGTGGAGCTATGTGCCAGTCC -3'
(R):5'- TGAGCAGTTTGTGCAGCTCGTC -3'

Sequencing Primer
(F):5'- AGCCTATACTACCATACCTGTCTGAG -3'
(R):5'- TGTGCAGCTCGTCCACTG -3'

Posted On

2013-05-09