Incidental Mutation 'R4744:Rbm47'
ID356567
Institutional Source Beutler Lab
Gene Symbol Rbm47
Ensembl Gene ENSMUSG00000070780
Gene NameRNA binding motif protein 47
Synonyms
MMRRC Submission 042027-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R4744 (G1)
Quality Score218
Status Validated
Chromosome5
Chromosomal Location66016549-66173118 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 66026693 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 189 (D189G)
Ref Sequence ENSEMBL: ENSMUSP00000144122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094756] [ENSMUST00000094757] [ENSMUST00000113724] [ENSMUST00000113726] [ENSMUST00000167950] [ENSMUST00000200775] [ENSMUST00000200852] [ENSMUST00000201544] [ENSMUST00000201561] [ENSMUST00000202700]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094756
AA Change: D189G

PolyPhen 2 Score 0.639 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000092348
Gene: ENSMUSG00000070780
AA Change: D189G

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
RRM 72 145 7.19e-16 SMART
RRM 152 229 3.74e-5 SMART
RRM 247 314 1.21e-13 SMART
low complexity region 330 342 N/A INTRINSIC
low complexity region 381 397 N/A INTRINSIC
low complexity region 489 502 N/A INTRINSIC
low complexity region 545 554 N/A INTRINSIC
low complexity region 559 570 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000094757
AA Change: D189G

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000092349
Gene: ENSMUSG00000070780
AA Change: D189G

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
RRM 72 145 7.19e-16 SMART
RRM 152 229 3.74e-5 SMART
RRM 247 314 1.21e-13 SMART
low complexity region 330 342 N/A INTRINSIC
low complexity region 381 397 N/A INTRINSIC
low complexity region 489 502 N/A INTRINSIC
low complexity region 545 554 N/A INTRINSIC
low complexity region 559 570 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113724
AA Change: D189G

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109353
Gene: ENSMUSG00000070780
AA Change: D189G

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
RRM 72 145 7.19e-16 SMART
RRM 152 229 3.74e-5 SMART
RRM 247 314 1.21e-13 SMART
low complexity region 330 342 N/A INTRINSIC
low complexity region 381 397 N/A INTRINSIC
low complexity region 489 502 N/A INTRINSIC
low complexity region 545 554 N/A INTRINSIC
low complexity region 559 570 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113726
AA Change: D189G

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109355
Gene: ENSMUSG00000070780
AA Change: D189G

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
RRM 72 145 7.19e-16 SMART
RRM 152 229 3.74e-5 SMART
RRM 247 314 1.21e-13 SMART
low complexity region 330 342 N/A INTRINSIC
low complexity region 381 397 N/A INTRINSIC
low complexity region 489 502 N/A INTRINSIC
low complexity region 545 554 N/A INTRINSIC
low complexity region 559 570 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132606
AA Change: T416A
Predicted Effect probably damaging
Transcript: ENSMUST00000167950
AA Change: D189G

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128016
Gene: ENSMUSG00000070780
AA Change: D189G

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
RRM 72 145 7.19e-16 SMART
RRM 152 229 3.74e-5 SMART
RRM 247 314 1.21e-13 SMART
low complexity region 330 342 N/A INTRINSIC
low complexity region 381 397 N/A INTRINSIC
low complexity region 489 502 N/A INTRINSIC
low complexity region 545 554 N/A INTRINSIC
low complexity region 559 570 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200775
AA Change: D189G

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144325
Gene: ENSMUSG00000070780
AA Change: D189G

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
RRM 72 145 7.19e-16 SMART
RRM 152 229 3.74e-5 SMART
RRM 247 314 1.21e-13 SMART
low complexity region 330 342 N/A INTRINSIC
low complexity region 381 397 N/A INTRINSIC
low complexity region 489 502 N/A INTRINSIC
low complexity region 545 554 N/A INTRINSIC
low complexity region 559 570 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200852
SMART Domains Protein: ENSMUSP00000144505
Gene: ENSMUSG00000070780

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
RRM 72 145 7.19e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201311
Predicted Effect probably damaging
Transcript: ENSMUST00000201544
AA Change: D189G

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144122
Gene: ENSMUSG00000070780
AA Change: D189G

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
RRM 72 145 7.19e-16 SMART
RRM 152 229 3.74e-5 SMART
RRM 247 314 1.21e-13 SMART
low complexity region 330 342 N/A INTRINSIC
low complexity region 381 397 N/A INTRINSIC
low complexity region 489 502 N/A INTRINSIC
low complexity region 545 554 N/A INTRINSIC
low complexity region 559 570 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201561
Predicted Effect probably benign
Transcript: ENSMUST00000202700
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202794
Meta Mutation Damage Score 0.9040 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 99% (82/83)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene-trapped allele exhibit partial prenatal lethality. Surviving adults are small and display impaired cytidine to uridine RNA editing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik T C 5: 114,879,556 S143P possibly damaging Het
4933427D14Rik T C 11: 72,175,539 K614E probably damaging Het
Aatk A G 11: 120,016,122 M155T possibly damaging Het
Acvr2b T C 9: 119,431,262 L333P probably damaging Het
Adam22 T C 5: 8,078,699 E865G probably damaging Het
Add2 A G 6: 86,110,888 S358G probably damaging Het
Agap2 T C 10: 127,090,203 probably null Het
Alkbh8 G A 9: 3,344,604 W49* probably null Het
AU015228 A T 2: 130,100,629 noncoding transcript Het
Bank1 G T 3: 136,247,689 R102S probably benign Het
Brap T A 5: 121,662,130 D27E probably damaging Het
Cyb5r2 G T 7: 107,750,277 H276N possibly damaging Het
Dhh A G 15: 98,894,258 F290L possibly damaging Het
Dhrs7 T A 12: 72,652,251 N319I possibly damaging Het
Ebpl A G 14: 61,360,233 V53A probably damaging Het
Eif3j2 TGCCGCCGCCGCCGCCGCCGCCGCCGCC TGCCGCCGCCGCCGCCGCCGCCGCC 18: 43,477,717 probably benign Het
Etnk1 A C 6: 143,186,593 N220T probably damaging Het
F11r T A 1: 171,460,598 V64D probably benign Het
Fam171a1 T C 2: 3,224,909 S360P probably damaging Het
Fignl1 A G 11: 11,801,585 M490T probably damaging Het
Fpr-rs7 A T 17: 20,114,003 M75K probably benign Het
Fzd7 T A 1: 59,484,436 F493I possibly damaging Het
Galnt14 G T 17: 73,507,833 P412T probably damaging Het
Gcg T A 2: 62,478,631 S60C probably damaging Het
Ggt1 A G 10: 75,585,899 K527E probably benign Het
Gm14085 A T 2: 122,522,805 K489* probably null Het
Gm16551 T A 9: 74,850,871 noncoding transcript Het
Gm9972 A G 11: 43,036,690 K55E unknown Het
Gpr141 T A 13: 19,751,714 D297V probably benign Het
Grin2b G A 6: 135,778,699 S539L probably damaging Het
Hhipl1 A T 12: 108,319,979 N515I possibly damaging Het
Hmcn1 T G 1: 150,577,612 E5317D probably damaging Het
Hsf5 T A 11: 87,622,791 N227K probably benign Het
Igfn1 A T 1: 135,982,458 D129E probably benign Het
Invs T C 4: 48,397,609 F339L probably damaging Het
Jak2 T A 19: 29,262,256 S17T probably benign Het
Mdga2 T A 12: 66,797,727 I166F probably benign Het
Nck1 T C 9: 100,506,744 I6V probably benign Het
Neb T C 2: 52,150,577 D6624G probably benign Het
Nmur2 A G 11: 56,040,835 Y17H probably benign Het
Nwd2 T C 5: 63,806,967 L1298P probably damaging Het
Ocel1 A G 8: 71,372,753 E161G probably damaging Het
Olfr345 A T 2: 36,640,979 probably null Het
Pabpc2 A G 18: 39,774,828 Y382C probably benign Het
Panx1 A G 9: 15,010,298 probably benign Het
Pdhx A T 2: 103,042,296 V147D probably benign Het
Pigz A T 16: 31,945,333 H403L probably damaging Het
Pilra T C 5: 137,835,507 probably null Het
Rhobtb2 A G 14: 69,794,002 L558P probably damaging Het
Scarf2 G A 16: 17,803,516 R322H probably damaging Het
Sept3 T C 15: 82,290,457 probably null Het
Sirt2 T C 7: 28,777,013 F26L probably damaging Het
Slc1a1 A T 19: 28,894,525 T133S probably benign Het
Slc1a2 A G 2: 102,737,869 I84V probably benign Het
Slc6a9 A T 4: 117,867,895 Q562L probably benign Het
Snx29 C T 16: 11,349,909 Q25* probably null Het
St6galnac6 A G 2: 32,618,543 I231V probably damaging Het
Stard9 A G 2: 120,696,123 T954A probably benign Het
Sufu A G 19: 46,483,630 M443V possibly damaging Het
Sv2b T C 7: 75,206,518 D8G probably benign Het
Tapbpl G A 6: 125,228,285 R233W probably damaging Het
Tex10 A G 4: 48,469,990 L25S probably benign Het
Trp53bp1 A T 2: 121,211,313 V1254D probably damaging Het
Ugt3a1 T A 15: 9,310,553 I307N probably benign Het
Unc13c T C 9: 73,931,844 D575G probably damaging Het
Usf2 A T 7: 30,954,772 D166E probably damaging Het
Usp25 T A 16: 77,114,989 L969M probably damaging Het
Usp32 G A 11: 84,994,393 P1276L probably damaging Het
Vmn2r8 T A 5: 108,808,581 E58D probably benign Het
Zfp462 G T 4: 55,011,598 C40F probably damaging Het
Other mutations in Rbm47
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00976:Rbm47 APN 5 66026738 missense possibly damaging 0.75
IGL01648:Rbm47 APN 5 66024978 missense possibly damaging 0.59
IGL02323:Rbm47 APN 5 66026429 missense probably damaging 1.00
IGL02456:Rbm47 APN 5 66027021 missense probably damaging 1.00
IGL03329:Rbm47 APN 5 66026693 missense probably damaging 0.98
PIT4402001:Rbm47 UTSW 5 66027011 missense probably damaging 1.00
R0131:Rbm47 UTSW 5 66026529 missense possibly damaging 0.86
R1575:Rbm47 UTSW 5 66025015 missense probably benign 0.00
R1587:Rbm47 UTSW 5 66024991 missense probably benign 0.23
R1645:Rbm47 UTSW 5 66027138 missense probably benign 0.44
R1750:Rbm47 UTSW 5 66019310 missense possibly damaging 0.78
R4085:Rbm47 UTSW 5 66022737 missense probably benign 0.05
R4087:Rbm47 UTSW 5 66022737 missense probably benign 0.05
R4090:Rbm47 UTSW 5 66022737 missense probably benign 0.05
R4280:Rbm47 UTSW 5 66026177 missense probably damaging 1.00
R4714:Rbm47 UTSW 5 66025052 missense probably damaging 1.00
R4807:Rbm47 UTSW 5 66019304 missense possibly damaging 0.71
R5453:Rbm47 UTSW 5 66027182 missense probably benign 0.07
R6090:Rbm47 UTSW 5 66026283 missense probably damaging 1.00
R6091:Rbm47 UTSW 5 66026283 missense probably damaging 1.00
R6136:Rbm47 UTSW 5 66026283 missense probably damaging 1.00
R6137:Rbm47 UTSW 5 66026283 missense probably damaging 1.00
R6159:Rbm47 UTSW 5 66026816 missense probably damaging 0.99
R6181:Rbm47 UTSW 5 66026490 missense possibly damaging 0.92
R6425:Rbm47 UTSW 5 66022816 missense probably damaging 1.00
R7292:Rbm47 UTSW 5 66026750 missense possibly damaging 0.86
R7332:Rbm47 UTSW 5 66026214 missense probably damaging 1.00
R7405:Rbm47 UTSW 5 66026495 missense probably damaging 0.98
Z1176:Rbm47 UTSW 5 66022672 missense probably benign 0.04
Z1176:Rbm47 UTSW 5 66026979 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- CGTAGAGGATCTTCACTGTCTGC -3'
(R):5'- CGTGATGTACTGCCACAAGC -3'

Sequencing Primer
(F):5'- AGAGGATCTTCACTGTCTGCATCAC -3'
(R):5'- AGCCGTTCGGGAACTCAAC -3'
Posted On2015-11-11