Incidental Mutation 'R4744:Brap'
ID356571
Institutional Source Beutler Lab
Gene Symbol Brap
Ensembl Gene ENSMUSG00000029458
Gene NameBRCA1 associated protein
Synonyms3010002G07Rik
MMRRC Submission 042027-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4744 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location121660563-121687256 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 121662130 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 27 (D27E)
Ref Sequence ENSEMBL: ENSMUSP00000143043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031412] [ENSMUST00000031414] [ENSMUST00000111765] [ENSMUST00000111770] [ENSMUST00000140996] [ENSMUST00000142701] [ENSMUST00000195952]
Predicted Effect probably benign
Transcript: ENSMUST00000031412
SMART Domains Protein: ENSMUSP00000031412
Gene: ENSMUSG00000029456

DomainStartEndE-ValueType
Pfam:HAD_2 45 231 1.6e-14 PFAM
Pfam:Hydrolase 88 225 5e-8 PFAM
Pfam:APH 287 531 1.8e-52 PFAM
Pfam:Acyl-CoA_dh_N 660 787 1.7e-15 PFAM
Pfam:Acyl-CoA_dh_M 791 892 2.7e-20 PFAM
Pfam:Acyl-CoA_dh_1 904 1055 1.1e-35 PFAM
Pfam:Acyl-CoA_dh_2 919 1037 6.4e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000031414
AA Change: D71E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000031414
Gene: ENSMUSG00000029458
AA Change: D71E

DomainStartEndE-ValueType
Pfam:BRAP2 153 251 3.7e-38 PFAM
RING 263 302 7.92e-8 SMART
ZnF_UBP 315 364 1.68e-25 SMART
coiled coil region 430 535 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111765
AA Change: D41E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107395
Gene: ENSMUSG00000029458
AA Change: D41E

DomainStartEndE-ValueType
Pfam:BRAP2 117 226 3.5e-41 PFAM
RING 233 272 3.7e-10 SMART
ZnF_UBP 285 334 1.1e-27 SMART
coiled coil region 400 505 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111770
SMART Domains Protein: ENSMUSP00000107400
Gene: ENSMUSG00000029456

DomainStartEndE-ValueType
Pfam:HAD_2 45 231 2.3e-14 PFAM
Pfam:APH 287 523 3.2e-50 PFAM
Pfam:EcKinase 390 504 5.2e-8 PFAM
Pfam:Acyl-CoA_dh_N 660 787 3.4e-14 PFAM
Pfam:Acyl-CoA_dh_M 791 845 2.7e-13 PFAM
Pfam:Acyl-CoA_dh_1 904 1055 9.4e-36 PFAM
Pfam:Acyl-CoA_dh_2 919 1037 1.6e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127703
SMART Domains Protein: ENSMUSP00000118574
Gene: ENSMUSG00000029458

DomainStartEndE-ValueType
Pfam:BRAP2 1 39 6.3e-13 PFAM
RING 46 85 7.92e-8 SMART
ZnF_UBP 98 147 1.68e-25 SMART
coiled coil region 213 318 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132491
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133775
Predicted Effect probably damaging
Transcript: ENSMUST00000140996
AA Change: D71E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000142701
AA Change: D27E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143043
Gene: ENSMUSG00000029458
AA Change: D27E

DomainStartEndE-ValueType
Pfam:BRAP2 103 175 3.8e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148052
Predicted Effect possibly damaging
Transcript: ENSMUST00000195952
AA Change: D30E

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.1298 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was identified by its ability to bind to the nuclear localization signal of BRCA1 and other proteins. It is a cytoplasmic protein which may regulate nuclear targeting by retaining proteins with a nuclear localization signal in the cytoplasm. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality during organogenesis and subtle defects in cell cycle-dependent nuclear movement in neural progenitors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik T C 5: 114,879,556 S143P possibly damaging Het
4933427D14Rik T C 11: 72,175,539 K614E probably damaging Het
Aatk A G 11: 120,016,122 M155T possibly damaging Het
Acvr2b T C 9: 119,431,262 L333P probably damaging Het
Adam22 T C 5: 8,078,699 E865G probably damaging Het
Add2 A G 6: 86,110,888 S358G probably damaging Het
Agap2 T C 10: 127,090,203 probably null Het
Alkbh8 G A 9: 3,344,604 W49* probably null Het
AU015228 A T 2: 130,100,629 noncoding transcript Het
Bank1 G T 3: 136,247,689 R102S probably benign Het
Cyb5r2 G T 7: 107,750,277 H276N possibly damaging Het
Dhh A G 15: 98,894,258 F290L possibly damaging Het
Dhrs7 T A 12: 72,652,251 N319I possibly damaging Het
Ebpl A G 14: 61,360,233 V53A probably damaging Het
Eif3j2 TGCCGCCGCCGCCGCCGCCGCCGCCGCC TGCCGCCGCCGCCGCCGCCGCCGCC 18: 43,477,717 probably benign Het
Etnk1 A C 6: 143,186,593 N220T probably damaging Het
F11r T A 1: 171,460,598 V64D probably benign Het
Fam171a1 T C 2: 3,224,909 S360P probably damaging Het
Fignl1 A G 11: 11,801,585 M490T probably damaging Het
Fpr-rs7 A T 17: 20,114,003 M75K probably benign Het
Fzd7 T A 1: 59,484,436 F493I possibly damaging Het
Galnt14 G T 17: 73,507,833 P412T probably damaging Het
Gcg T A 2: 62,478,631 S60C probably damaging Het
Ggt1 A G 10: 75,585,899 K527E probably benign Het
Gm14085 A T 2: 122,522,805 K489* probably null Het
Gm16551 T A 9: 74,850,871 noncoding transcript Het
Gm9972 A G 11: 43,036,690 K55E unknown Het
Gpr141 T A 13: 19,751,714 D297V probably benign Het
Grin2b G A 6: 135,778,699 S539L probably damaging Het
Hhipl1 A T 12: 108,319,979 N515I possibly damaging Het
Hmcn1 T G 1: 150,577,612 E5317D probably damaging Het
Hsf5 T A 11: 87,622,791 N227K probably benign Het
Igfn1 A T 1: 135,982,458 D129E probably benign Het
Invs T C 4: 48,397,609 F339L probably damaging Het
Jak2 T A 19: 29,262,256 S17T probably benign Het
Mdga2 T A 12: 66,797,727 I166F probably benign Het
Nck1 T C 9: 100,506,744 I6V probably benign Het
Neb T C 2: 52,150,577 D6624G probably benign Het
Nmur2 A G 11: 56,040,835 Y17H probably benign Het
Nwd2 T C 5: 63,806,967 L1298P probably damaging Het
Ocel1 A G 8: 71,372,753 E161G probably damaging Het
Olfr345 A T 2: 36,640,979 probably null Het
Pabpc2 A G 18: 39,774,828 Y382C probably benign Het
Panx1 A G 9: 15,010,298 probably benign Het
Pdhx A T 2: 103,042,296 V147D probably benign Het
Pigz A T 16: 31,945,333 H403L probably damaging Het
Pilra T C 5: 137,835,507 probably null Het
Rbm47 T C 5: 66,026,693 D189G probably damaging Het
Rhobtb2 A G 14: 69,794,002 L558P probably damaging Het
Scarf2 G A 16: 17,803,516 R322H probably damaging Het
Sept3 T C 15: 82,290,457 probably null Het
Sirt2 T C 7: 28,777,013 F26L probably damaging Het
Slc1a1 A T 19: 28,894,525 T133S probably benign Het
Slc1a2 A G 2: 102,737,869 I84V probably benign Het
Slc6a9 A T 4: 117,867,895 Q562L probably benign Het
Snx29 C T 16: 11,349,909 Q25* probably null Het
St6galnac6 A G 2: 32,618,543 I231V probably damaging Het
Stard9 A G 2: 120,696,123 T954A probably benign Het
Sufu A G 19: 46,483,630 M443V possibly damaging Het
Sv2b T C 7: 75,206,518 D8G probably benign Het
Tapbpl G A 6: 125,228,285 R233W probably damaging Het
Tex10 A G 4: 48,469,990 L25S probably benign Het
Trp53bp1 A T 2: 121,211,313 V1254D probably damaging Het
Ugt3a1 T A 15: 9,310,553 I307N probably benign Het
Unc13c T C 9: 73,931,844 D575G probably damaging Het
Usf2 A T 7: 30,954,772 D166E probably damaging Het
Usp25 T A 16: 77,114,989 L969M probably damaging Het
Usp32 G A 11: 84,994,393 P1276L probably damaging Het
Vmn2r8 T A 5: 108,808,581 E58D probably benign Het
Zfp462 G T 4: 55,011,598 C40F probably damaging Het
Other mutations in Brap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Brap APN 5 121665227 missense probably damaging 1.00
IGL01672:Brap APN 5 121678845 unclassified probably benign
IGL01889:Brap APN 5 121660818 missense probably benign 0.00
IGL01977:Brap APN 5 121678847 unclassified probably benign
IGL01978:Brap APN 5 121678847 unclassified probably benign
IGL01996:Brap APN 5 121678847 unclassified probably benign
IGL02499:Brap APN 5 121679871 missense probably damaging 0.99
IGL03137:Brap APN 5 121665093 splice site probably benign
R1185:Brap UTSW 5 121675279 missense probably damaging 1.00
R1185:Brap UTSW 5 121675279 missense probably damaging 1.00
R1185:Brap UTSW 5 121675279 missense probably damaging 1.00
R1624:Brap UTSW 5 121682859 missense possibly damaging 0.65
R1709:Brap UTSW 5 121665290 critical splice donor site probably null
R2056:Brap UTSW 5 121663466 missense probably damaging 1.00
R2109:Brap UTSW 5 121663359 missense possibly damaging 0.63
R3196:Brap UTSW 5 121665196 missense possibly damaging 0.70
R4591:Brap UTSW 5 121662050 missense probably null 1.00
R4924:Brap UTSW 5 121665255 missense probably damaging 1.00
R5000:Brap UTSW 5 121662026 nonsense probably null
R5702:Brap UTSW 5 121665143 missense probably damaging 1.00
R5893:Brap UTSW 5 121679342 nonsense probably null
R6244:Brap UTSW 5 121665309 missense probably benign 0.02
R6266:Brap UTSW 5 121685265 missense probably benign 0.00
R6726:Brap UTSW 5 121675302 missense probably damaging 1.00
R7765:Brap UTSW 5 121662129 missense probably damaging 1.00
R7995:Brap UTSW 5 121682846 missense probably benign
X0003:Brap UTSW 5 121679256 missense probably damaging 1.00
Z1176:Brap UTSW 5 121675377 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- AAAAGAGCCTCATCCAGGGG -3'
(R):5'- TCACATAAAGAACACAAGTGCTGG -3'

Sequencing Primer
(F):5'- CAGGAAAGCTATTGATTGATGTGCC -3'
(R):5'- GCGCTAGCCTTACATGTATGAAGC -3'
Posted On2015-11-11