Mutagenetix > Incidental Mutation

Incidental Mutation 'R4744:Grin2b'

356575

Institutional Source

Beutler Lab

Gene Symbol

Grin2b

Ensembl Gene

ENSMUSG00000030209

Gene Name

glutamate receptor, ionotropic, NMDA2B (epsilon 2)

Synonyms

GluRepsilon2, NMDAR2B, GluN2B, Nmdar2b, NR2B

MMRRC Submission

042027-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4744 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

135713233-136173511 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 135778699 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Leucine at position 539 (S539L)

Ref Sequence

ENSEMBL: ENSMUSP00000107536 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053880] [ENSMUST00000111905]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000053880
AA Change: S539L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000062284
Gene: ENSMUSG00000030209
AA Change: S539L

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	106	306	8.6e-10	PFAM
PBPe	431	799	1.06e-67	SMART
Lig_chan-Glu_bd	440	503	1.82e-22	SMART
Pfam:NMDAR2_C	840	1482	4.8e-270	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000111905
AA Change: S539L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000107536
Gene: ENSMUSG00000030209
AA Change: S539L

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	56	307	4.2e-10	PFAM
PBPe	431	799	1.06e-67	SMART
Lig_chan-Glu_bd	440	503	1.82e-22	SMART
Pfam:NMDAR2_C	840	1482	2.1e-245	PFAM

Meta Mutation Damage Score

0.3329

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

99% (82/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA receptor channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of three different subunits: NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The NR2 subunit acts as the agonist binding site for glutamate. This receptor is the predominant excitatory neurotransmitter receptor in the mammalian brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in suckling, in hippocampal long term depression, and in pattern formation of trigeminal nucleus sensory afferent terminals. Mutants die shortly after birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930519G04Rik	T	C	5: 114,879,556	S143P	possibly damaging	Het
4933427D14Rik	T	C	11: 72,175,539	K614E	probably damaging	Het
Aatk	A	G	11: 120,016,122	M155T	possibly damaging	Het
Acvr2b	T	C	9: 119,431,262	L333P	probably damaging	Het
Adam22	T	C	5: 8,078,699	E865G	probably damaging	Het
Add2	A	G	6: 86,110,888	S358G	probably damaging	Het
Agap2	T	C	10: 127,090,203		probably null	Het
Alkbh8	G	A	9: 3,344,604	W49*	probably null	Het
AU015228	A	T	2: 130,100,629		noncoding transcript	Het
Bank1	G	T	3: 136,247,689	R102S	probably benign	Het
Brap	T	A	5: 121,662,130	D27E	probably damaging	Het
Cyb5r2	G	T	7: 107,750,277	H276N	possibly damaging	Het
Dhh	A	G	15: 98,894,258	F290L	possibly damaging	Het
Dhrs7	T	A	12: 72,652,251	N319I	possibly damaging	Het
Ebpl	A	G	14: 61,360,233	V53A	probably damaging	Het
Eif3j2	TGCCGCCGCCGCCGCCGCCGCCGCCGCC	TGCCGCCGCCGCCGCCGCCGCCGCC	18: 43,477,717		probably benign	Het
Etnk1	A	C	6: 143,186,593	N220T	probably damaging	Het
F11r	T	A	1: 171,460,598	V64D	probably benign	Het
Fam171a1	T	C	2: 3,224,909	S360P	probably damaging	Het
Fignl1	A	G	11: 11,801,585	M490T	probably damaging	Het
Fpr-rs7	A	T	17: 20,114,003	M75K	probably benign	Het
Fzd7	T	A	1: 59,484,436	F493I	possibly damaging	Het
Galnt14	G	T	17: 73,507,833	P412T	probably damaging	Het
Gcg	T	A	2: 62,478,631	S60C	probably damaging	Het
Ggt1	A	G	10: 75,585,899	K527E	probably benign	Het
Gm14085	A	T	2: 122,522,805	K489*	probably null	Het
Gm16551	T	A	9: 74,850,871		noncoding transcript	Het
Gm9972	A	G	11: 43,036,690	K55E	unknown	Het
Gpr141	T	A	13: 19,751,714	D297V	probably benign	Het
Hhipl1	A	T	12: 108,319,979	N515I	possibly damaging	Het
Hmcn1	T	G	1: 150,577,612	E5317D	probably damaging	Het
Hsf5	T	A	11: 87,622,791	N227K	probably benign	Het
Igfn1	A	T	1: 135,982,458	D129E	probably benign	Het
Invs	T	C	4: 48,397,609	F339L	probably damaging	Het
Jak2	T	A	19: 29,262,256	S17T	probably benign	Het
Mdga2	T	A	12: 66,797,727	I166F	probably benign	Het
Nck1	T	C	9: 100,506,744	I6V	probably benign	Het
Neb	T	C	2: 52,150,577	D6624G	probably benign	Het
Nmur2	A	G	11: 56,040,835	Y17H	probably benign	Het
Nwd2	T	C	5: 63,806,967	L1298P	probably damaging	Het
Ocel1	A	G	8: 71,372,753	E161G	probably damaging	Het
Olfr345	A	T	2: 36,640,979		probably null	Het
Pabpc2	A	G	18: 39,774,828	Y382C	probably benign	Het
Panx1	A	G	9: 15,010,298		probably benign	Het
Pdhx	A	T	2: 103,042,296	V147D	probably benign	Het
Pigz	A	T	16: 31,945,333	H403L	probably damaging	Het
Pilra	T	C	5: 137,835,507		probably null	Het
Rbm47	T	C	5: 66,026,693	D189G	probably damaging	Het
Rhobtb2	A	G	14: 69,794,002	L558P	probably damaging	Het
Scarf2	G	A	16: 17,803,516	R322H	probably damaging	Het
Sept3	T	C	15: 82,290,457		probably null	Het
Sirt2	T	C	7: 28,777,013	F26L	probably damaging	Het
Slc1a1	A	T	19: 28,894,525	T133S	probably benign	Het
Slc1a2	A	G	2: 102,737,869	I84V	probably benign	Het
Slc6a9	A	T	4: 117,867,895	Q562L	probably benign	Het
Snx29	C	T	16: 11,349,909	Q25*	probably null	Het
St6galnac6	A	G	2: 32,618,543	I231V	probably damaging	Het
Stard9	A	G	2: 120,696,123	T954A	probably benign	Het
Sufu	A	G	19: 46,483,630	M443V	possibly damaging	Het
Sv2b	T	C	7: 75,206,518	D8G	probably benign	Het
Tapbpl	G	A	6: 125,228,285	R233W	probably damaging	Het
Tex10	A	G	4: 48,469,990	L25S	probably benign	Het
Trp53bp1	A	T	2: 121,211,313	V1254D	probably damaging	Het
Ugt3a1	T	A	15: 9,310,553	I307N	probably benign	Het
Unc13c	T	C	9: 73,931,844	D575G	probably damaging	Het
Usf2	A	T	7: 30,954,772	D166E	probably damaging	Het
Usp25	T	A	16: 77,114,989	L969M	probably damaging	Het
Usp32	G	A	11: 84,994,393	P1276L	probably damaging	Het
Vmn2r8	T	A	5: 108,808,581	E58D	probably benign	Het
Zfp462	G	T	4: 55,011,598	C40F	probably damaging	Het

Other mutations in Grin2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00494:Grin2b	APN	6	135736331	missense	possibly damaging	0.55
IGL00835:Grin2b	APN	6	135733570	missense	probably damaging	1.00
IGL01401:Grin2b	APN	6	135736363	missense	probably damaging	1.00
IGL01523:Grin2b	APN	6	136044265	missense	probably null	0.99
IGL01719:Grin2b	APN	6	135733381	missense	probably damaging	0.97
IGL01907:Grin2b	APN	6	135733740	missense	probably damaging	1.00
IGL01996:Grin2b	APN	6	135732586	missense	probably damaging	1.00
IGL02309:Grin2b	APN	6	135736472	missense	probably damaging	1.00
IGL02312:Grin2b	APN	6	135739090	missense	probably damaging	1.00
IGL02409:Grin2b	APN	6	136043908	missense	possibly damaging	0.89
IGL02527:Grin2b	APN	6	135923391	missense	probably damaging	1.00
IGL02535:Grin2b	APN	6	135779369	missense	possibly damaging	0.70
IGL02570:Grin2b	APN	6	135922998	missense	probably damaging	1.00
IGL02702:Grin2b	APN	6	135739132	missense	probably damaging	0.99
IGL03001:Grin2b	APN	6	135739115	missense	probably damaging	1.00
IGL03274:Grin2b	APN	6	135780255	missense	possibly damaging	0.90
R0055:Grin2b	UTSW	6	135923203	missense	probably benign
R0055:Grin2b	UTSW	6	135923203	missense	probably benign
R0164:Grin2b	UTSW	6	135778648	splice site	probably benign
R0194:Grin2b	UTSW	6	135779305	missense	probably damaging	1.00
R0594:Grin2b	UTSW	6	135733929	missense	probably damaging	1.00
R1434:Grin2b	UTSW	6	135843195	missense	probably benign	0.04
R1928:Grin2b	UTSW	6	136044046	missense	probably damaging	1.00
R1942:Grin2b	UTSW	6	135732732	missense	possibly damaging	0.93
R1996:Grin2b	UTSW	6	136044211	missense	possibly damaging	0.52
R2002:Grin2b	UTSW	6	135733245	missense	probably damaging	1.00
R2020:Grin2b	UTSW	6	135733896	missense	probably benign	0.12
R2103:Grin2b	UTSW	6	135780140	missense	probably benign	0.02
R2127:Grin2b	UTSW	6	135778700	missense	probably benign	0.03
R2495:Grin2b	UTSW	6	135733182	missense	probably damaging	1.00
R2656:Grin2b	UTSW	6	135733429	missense	probably damaging	1.00
R2847:Grin2b	UTSW	6	135740953	missense	probably damaging	1.00
R2866:Grin2b	UTSW	6	135733639	missense	probably damaging	1.00
R2867:Grin2b	UTSW	6	135733639	missense	probably damaging	1.00
R2867:Grin2b	UTSW	6	135733639	missense	probably damaging	1.00
R3196:Grin2b	UTSW	6	135732455	small deletion	probably benign
R3418:Grin2b	UTSW	6	135843110	missense	probably benign	0.02
R3808:Grin2b	UTSW	6	135923271	missense	probably damaging	0.99
R4028:Grin2b	UTSW	6	135736435	missense	probably damaging	1.00
R4602:Grin2b	UTSW	6	135778741	missense	probably damaging	1.00
R4624:Grin2b	UTSW	6	135733825	missense	probably damaging	0.99
R4677:Grin2b	UTSW	6	135774872	missense	probably benign	0.13
R5020:Grin2b	UTSW	6	135733407	missense	probably benign	0.01
R5051:Grin2b	UTSW	6	135779395	missense	possibly damaging	0.84
R5105:Grin2b	UTSW	6	135732441	missense	probably benign	0.03
R5125:Grin2b	UTSW	6	135923299	missense	possibly damaging	0.89
R5146:Grin2b	UTSW	6	135779342	missense	probably damaging	1.00
R5318:Grin2b	UTSW	6	135733918	missense	probably damaging	0.99
R5349:Grin2b	UTSW	6	136044283	missense	possibly damaging	0.93
R5426:Grin2b	UTSW	6	135732368	missense	probably damaging	1.00
R5438:Grin2b	UTSW	6	135736306	missense	probably damaging	1.00
R5439:Grin2b	UTSW	6	135736306	missense	probably damaging	1.00
R5440:Grin2b	UTSW	6	135736306	missense	probably damaging	1.00
R5530:Grin2b	UTSW	6	135733723	missense	probably benign	0.00
R5603:Grin2b	UTSW	6	135923397	missense	probably damaging	1.00
R5657:Grin2b	UTSW	6	135733087	missense	possibly damaging	0.48
R5788:Grin2b	UTSW	6	135740964	missense	probably benign	0.24
R5941:Grin2b	UTSW	6	135736373	missense	probably damaging	0.99
R6057:Grin2b	UTSW	6	135733944	missense	possibly damaging	0.84
R6137:Grin2b	UTSW	6	135923458	missense	possibly damaging	0.89
R6216:Grin2b	UTSW	6	135772399	missense	probably damaging	1.00
R6309:Grin2b	UTSW	6	135733027	missense	probably benign	0.00
R6316:Grin2b	UTSW	6	135780279	missense	probably benign	0.00
R6419:Grin2b	UTSW	6	135740967	missense	probably damaging	1.00
R6551:Grin2b	UTSW	6	135733344	missense	probably damaging	1.00
R6612:Grin2b	UTSW	6	135740998	missense	probably damaging	1.00
R6616:Grin2b	UTSW	6	135732551	missense	probably benign
R6647:Grin2b	UTSW	6	135733110	missense	probably damaging	1.00
R6806:Grin2b	UTSW	6	135774828	missense	possibly damaging	0.84
R6976:Grin2b	UTSW	6	135780200	missense	probably benign
R7033:Grin2b	UTSW	6	135923038	missense	probably damaging	1.00
R7058:Grin2b	UTSW	6	135780306	missense	probably damaging	0.97
R7144:Grin2b	UTSW	6	135733476	missense	possibly damaging	0.50
R7190:Grin2b	UTSW	6	135732948	missense	possibly damaging	0.46
R7238:Grin2b	UTSW	6	135780251	missense	probably damaging	0.97
R7453:Grin2b	UTSW	6	135740949	missense	possibly damaging	0.56
R7553:Grin2b	UTSW	6	135772396	missense	possibly damaging	0.88
R7585:Grin2b	UTSW	6	135779303	missense	probably damaging	0.99
R7615:Grin2b	UTSW	6	135923364	missense	probably damaging	1.00
R7632:Grin2b	UTSW	6	135732555	missense	probably benign	0.02
R7779:Grin2b	UTSW	6	135778794	nonsense	probably null
R8058:Grin2b	UTSW	6	135733227	missense	probably damaging	1.00
R8084:Grin2b	UTSW	6	135733488	missense	probably benign	0.03
R8145:Grin2b	UTSW	6	135732499	missense	probably benign	0.01
R8308:Grin2b	UTSW	6	135923076	missense	probably damaging	0.99
R8357:Grin2b	UTSW	6	135732199	missense	probably benign	0.00
R8379:Grin2b	UTSW	6	135922969	missense	probably damaging	1.00
R8429:Grin2b	UTSW	6	135733916	missense	probably damaging	1.00
R8457:Grin2b	UTSW	6	135732199	missense	probably benign	0.00
R8746:Grin2b	UTSW	6	135922987	missense	probably benign	0.02
R8925:Grin2b	UTSW	6	135772341	missense	probably damaging	0.97
R8927:Grin2b	UTSW	6	135772341	missense	probably damaging	0.97
R8963:Grin2b	UTSW	6	136044009	missense	probably damaging	1.00
R9075:Grin2b	UTSW	6	135732511	frame shift	probably null
R9076:Grin2b	UTSW	6	135732511	frame shift	probably null
R9172:Grin2b	UTSW	6	135779257	missense	possibly damaging	0.84
R9520:Grin2b	UTSW	6	135733401	missense	probably damaging	1.00
R9740:Grin2b	UTSW	6	135922870	critical splice donor site	probably null
RF001:Grin2b	UTSW	6	136044240	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ATCATACCTCAATGATTCCTGGGTG -3'
(R):5'- CTGGGCCATGAGAATTTTGCC -3'

Sequencing Primer
(F):5'- CAATGATTCCTGGGTGCTCTTAATG -3'
(R):5'- CCATGAGAATTTTGCCTGTGATGGAC -3'

Posted On

2015-11-11