Mutagenetix > Incidental Mutations

Incidental Mutation 'R4744:Panx1'

356584

Institutional Source

Beutler Lab

Gene Symbol

Panx1

Ensembl Gene

ENSMUSG00000031934

Gene Name

pannexin 1

Synonyms

MMRRC Submission

042027-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4744 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

15002128-15045478 bp(-) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

A to G at 15010298 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000132764 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056755] [ENSMUST00000164273] [ENSMUST00000169288]

Predicted Effect

probably benign
Transcript: ENSMUST00000056755

SMART Domains

Protein: ENSMUSP00000053557
Gene: ENSMUSG00000031934

Domain	Start	End	E-Value	Type
Pfam:Innexin	31	102	1.2e-8	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000164273

SMART Domains

Protein: ENSMUSP00000126405
Gene: ENSMUSG00000031934

Domain	Start	End	E-Value	Type
Pfam:Innexin	33	256	2.1e-16	PFAM
transmembrane domain	274	296	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000166933

Predicted Effect

probably benign
Transcript: ENSMUST00000169288

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

99% (82/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the innexin family. Innexin family members are the structural components of gap junctions. This protein and pannexin 2 are abundantly expressed in central nerve system (CNS) and are coexpressed in various neuronal populations. Studies in Xenopus oocytes suggest that this protein alone and in combination with pannexin 2 may form cell type-specific gap junctions with distinct properties. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired macrophage recruitment, YO-PRO-1 dye uptake, ATP release by apoptotic thymocytes, hippocampal neurons, and astrocytes. Mice homozygous for a different knock-out allele exhibit protection from I/R-induced retinal ganglion cell loss. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930519G04Rik	T	C	5: 114,879,556	S143P	possibly damaging	Het
4933427D14Rik	T	C	11: 72,175,539	K614E	probably damaging	Het
Aatk	A	G	11: 120,016,122	M155T	possibly damaging	Het
Acvr2b	T	C	9: 119,431,262	L333P	probably damaging	Het
Adam22	T	C	5: 8,078,699	E865G	probably damaging	Het
Add2	A	G	6: 86,110,888	S358G	probably damaging	Het
Agap2	T	C	10: 127,090,203		probably null	Het
Alkbh8	G	A	9: 3,344,604	W49*	probably null	Het
AU015228	A	T	2: 130,100,629		noncoding transcript	Het
Bank1	G	T	3: 136,247,689	R102S	probably benign	Het
Brap	T	A	5: 121,662,130	D27E	probably damaging	Het
Cyb5r2	G	T	7: 107,750,277	H276N	possibly damaging	Het
Dhh	A	G	15: 98,894,258	F290L	possibly damaging	Het
Dhrs7	T	A	12: 72,652,251	N319I	possibly damaging	Het
Ebpl	A	G	14: 61,360,233	V53A	probably damaging	Het
Eif3j2	TGCCGCCGCCGCCGCCGCCGCCGCCGCC	TGCCGCCGCCGCCGCCGCCGCCGCC	18: 43,477,717		probably benign	Het
Etnk1	A	C	6: 143,186,593	N220T	probably damaging	Het
F11r	T	A	1: 171,460,598	V64D	probably benign	Het
Fam171a1	T	C	2: 3,224,909	S360P	probably damaging	Het
Fignl1	A	G	11: 11,801,585	M490T	probably damaging	Het
Fpr-rs7	A	T	17: 20,114,003	M75K	probably benign	Het
Fzd7	T	A	1: 59,484,436	F493I	possibly damaging	Het
Galnt14	G	T	17: 73,507,833	P412T	probably damaging	Het
Gcg	T	A	2: 62,478,631	S60C	probably damaging	Het
Ggt1	A	G	10: 75,585,899	K527E	probably benign	Het
Gm14085	A	T	2: 122,522,805	K489*	probably null	Het
Gm16551	T	A	9: 74,850,871		noncoding transcript	Het
Gm9972	A	G	11: 43,036,690	K55E	unknown	Het
Gpr141	T	A	13: 19,751,714	D297V	probably benign	Het
Grin2b	G	A	6: 135,778,699	S539L	probably damaging	Het
Hhipl1	A	T	12: 108,319,979	N515I	possibly damaging	Het
Hmcn1	T	G	1: 150,577,612	E5317D	probably damaging	Het
Hsf5	T	A	11: 87,622,791	N227K	probably benign	Het
Igfn1	A	T	1: 135,982,458	D129E	probably benign	Het
Invs	T	C	4: 48,397,609	F339L	probably damaging	Het
Jak2	T	A	19: 29,262,256	S17T	probably benign	Het
Mdga2	T	A	12: 66,797,727	I166F	probably benign	Het
Nck1	T	C	9: 100,506,744	I6V	probably benign	Het
Neb	T	C	2: 52,150,577	D6624G	probably benign	Het
Nmur2	A	G	11: 56,040,835	Y17H	probably benign	Het
Nwd2	T	C	5: 63,806,967	L1298P	probably damaging	Het
Ocel1	A	G	8: 71,372,753	E161G	probably damaging	Het
Olfr345	A	T	2: 36,640,979		probably null	Het
Pabpc2	A	G	18: 39,774,828	Y382C	probably benign	Het
Pdhx	A	T	2: 103,042,296	V147D	probably benign	Het
Pigz	A	T	16: 31,945,333	H403L	probably damaging	Het
Pilra	T	C	5: 137,835,507		probably null	Het
Rbm47	T	C	5: 66,026,693	D189G	probably damaging	Het
Rhobtb2	A	G	14: 69,794,002	L558P	probably damaging	Het
Scarf2	G	A	16: 17,803,516	R322H	probably damaging	Het
Sept3	T	C	15: 82,290,457		probably null	Het
Sirt2	T	C	7: 28,777,013	F26L	probably damaging	Het
Slc1a1	A	T	19: 28,894,525	T133S	probably benign	Het
Slc1a2	A	G	2: 102,737,869	I84V	probably benign	Het
Slc6a9	A	T	4: 117,867,895	Q562L	probably benign	Het
Snx29	C	T	16: 11,349,909	Q25*	probably null	Het
St6galnac6	A	G	2: 32,618,543	I231V	probably damaging	Het
Stard9	A	G	2: 120,696,123	T954A	probably benign	Het
Sufu	A	G	19: 46,483,630	M443V	possibly damaging	Het
Sv2b	T	C	7: 75,206,518	D8G	probably benign	Het
Tapbpl	G	A	6: 125,228,285	R233W	probably damaging	Het
Tex10	A	G	4: 48,469,990	L25S	probably benign	Het
Trp53bp1	A	T	2: 121,211,313	V1254D	probably damaging	Het
Ugt3a1	T	A	15: 9,310,553	I307N	probably benign	Het
Unc13c	T	C	9: 73,931,844	D575G	probably damaging	Het
Usf2	A	T	7: 30,954,772	D166E	probably damaging	Het
Usp25	T	A	16: 77,114,989	L969M	probably damaging	Het
Usp32	G	A	11: 84,994,393	P1276L	probably damaging	Het
Vmn2r8	T	A	5: 108,808,581	E58D	probably benign	Het
Zfp462	G	T	4: 55,011,598	C40F	probably damaging	Het

Other mutations in Panx1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00835:Panx1	APN	9	15007844	missense	probably damaging	0.97
IGL01364:Panx1	APN	9	15021465	missense	probably damaging	1.00
IGL02831:Panx1	APN	9	15007648	missense	probably damaging	1.00
IGL02861:Panx1	APN	9	15007805	missense	probably benign
cathedral	UTSW	9	15007633	missense	possibly damaging	0.53
elephant	UTSW	9	15010217	missense	probably damaging	1.00
notre_dame	UTSW	9	15010217	missense	probably damaging	1.00
R0422:Panx1	UTSW	9	15007816	nonsense	probably null
R0602:Panx1	UTSW	9	15010204	missense	probably damaging	1.00
R1509:Panx1	UTSW	9	15010045	missense	possibly damaging	0.53
R1681:Panx1	UTSW	9	15007783	missense	probably benign	0.13
R1862:Panx1	UTSW	9	15007428	missense	probably damaging	1.00
R1895:Panx1	UTSW	9	15007526	missense	probably benign	0.13
R1937:Panx1	UTSW	9	15007684	missense	possibly damaging	0.68
R1946:Panx1	UTSW	9	15007526	missense	probably benign	0.13
R2447:Panx1	UTSW	9	15044889	missense	probably damaging	0.99
R3732:Panx1	UTSW	9	15006171	unclassified	probably benign
R3732:Panx1	UTSW	9	15006171	unclassified	probably benign
R3733:Panx1	UTSW	9	15006171	unclassified	probably benign
R3734:Panx1	UTSW	9	15006171	unclassified	probably benign
R3958:Panx1	UTSW	9	15006171	unclassified	probably benign
R3960:Panx1	UTSW	9	15006171	unclassified	probably benign
R4990:Panx1	UTSW	9	15010217	missense	probably damaging	1.00
R5272:Panx1	UTSW	9	15044856	critical splice donor site	probably null
R5556:Panx1	UTSW	9	15007633	missense	possibly damaging	0.53
R5935:Panx1	UTSW	9	15010217	missense	probably damaging	1.00
R6126:Panx1	UTSW	9	15007790	missense	probably benign	0.38
R6683:Panx1	UTSW	9	15008011	missense	probably benign	0.41
R6743:Panx1	UTSW	9	15007633	missense	possibly damaging	0.53
R6873:Panx1	UTSW	9	15010217	missense	probably damaging	1.00
R7944:Panx1	UTSW	9	15007829	missense	probably damaging	1.00
R8061:Panx1	UTSW	9	15045001	missense	possibly damaging	0.58
Z1177:Panx1	UTSW	9	15007814	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAAATCTCGAGCACTCTTGGC -3'
(R):5'- ACCACTTCCTACCAGTTGATG -3'

Sequencing Primer
(F):5'- CACTCTTGGCAGCCTTGATGG -3'
(R):5'- CCTACCAGTTGATGTCTATTGAATGG -3'

Posted On

2015-11-11