Incidental Mutation 'R4744:Panx1'
ID356584
Institutional Source Beutler Lab
Gene Symbol Panx1
Ensembl Gene ENSMUSG00000031934
Gene Namepannexin 1
Synonyms
MMRRC Submission 042027-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4744 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location15002128-15045478 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 15010298 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132764 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056755] [ENSMUST00000164273] [ENSMUST00000169288]
Predicted Effect probably benign
Transcript: ENSMUST00000056755
SMART Domains Protein: ENSMUSP00000053557
Gene: ENSMUSG00000031934

DomainStartEndE-ValueType
Pfam:Innexin 31 102 1.2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164273
SMART Domains Protein: ENSMUSP00000126405
Gene: ENSMUSG00000031934

DomainStartEndE-ValueType
Pfam:Innexin 33 256 2.1e-16 PFAM
transmembrane domain 274 296 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166933
Predicted Effect probably benign
Transcript: ENSMUST00000169288
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the innexin family. Innexin family members are the structural components of gap junctions. This protein and pannexin 2 are abundantly expressed in central nerve system (CNS) and are coexpressed in various neuronal populations. Studies in Xenopus oocytes suggest that this protein alone and in combination with pannexin 2 may form cell type-specific gap junctions with distinct properties. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired macrophage recruitment, YO-PRO-1 dye uptake, ATP release by apoptotic thymocytes, hippocampal neurons, and astrocytes. Mice homozygous for a different knock-out allele exhibit protection from I/R-induced retinal ganglion cell loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik T C 5: 114,879,556 S143P possibly damaging Het
4933427D14Rik T C 11: 72,175,539 K614E probably damaging Het
Aatk A G 11: 120,016,122 M155T possibly damaging Het
Acvr2b T C 9: 119,431,262 L333P probably damaging Het
Adam22 T C 5: 8,078,699 E865G probably damaging Het
Add2 A G 6: 86,110,888 S358G probably damaging Het
Agap2 T C 10: 127,090,203 probably null Het
Alkbh8 G A 9: 3,344,604 W49* probably null Het
AU015228 A T 2: 130,100,629 noncoding transcript Het
Bank1 G T 3: 136,247,689 R102S probably benign Het
Brap T A 5: 121,662,130 D27E probably damaging Het
Cyb5r2 G T 7: 107,750,277 H276N possibly damaging Het
Dhh A G 15: 98,894,258 F290L possibly damaging Het
Dhrs7 T A 12: 72,652,251 N319I possibly damaging Het
Ebpl A G 14: 61,360,233 V53A probably damaging Het
Eif3j2 TGCCGCCGCCGCCGCCGCCGCCGCCGCC TGCCGCCGCCGCCGCCGCCGCCGCC 18: 43,477,717 probably benign Het
Etnk1 A C 6: 143,186,593 N220T probably damaging Het
F11r T A 1: 171,460,598 V64D probably benign Het
Fam171a1 T C 2: 3,224,909 S360P probably damaging Het
Fignl1 A G 11: 11,801,585 M490T probably damaging Het
Fpr-rs7 A T 17: 20,114,003 M75K probably benign Het
Fzd7 T A 1: 59,484,436 F493I possibly damaging Het
Galnt14 G T 17: 73,507,833 P412T probably damaging Het
Gcg T A 2: 62,478,631 S60C probably damaging Het
Ggt1 A G 10: 75,585,899 K527E probably benign Het
Gm14085 A T 2: 122,522,805 K489* probably null Het
Gm16551 T A 9: 74,850,871 noncoding transcript Het
Gm9972 A G 11: 43,036,690 K55E unknown Het
Gpr141 T A 13: 19,751,714 D297V probably benign Het
Grin2b G A 6: 135,778,699 S539L probably damaging Het
Hhipl1 A T 12: 108,319,979 N515I possibly damaging Het
Hmcn1 T G 1: 150,577,612 E5317D probably damaging Het
Hsf5 T A 11: 87,622,791 N227K probably benign Het
Igfn1 A T 1: 135,982,458 D129E probably benign Het
Invs T C 4: 48,397,609 F339L probably damaging Het
Jak2 T A 19: 29,262,256 S17T probably benign Het
Mdga2 T A 12: 66,797,727 I166F probably benign Het
Nck1 T C 9: 100,506,744 I6V probably benign Het
Neb T C 2: 52,150,577 D6624G probably benign Het
Nmur2 A G 11: 56,040,835 Y17H probably benign Het
Nwd2 T C 5: 63,806,967 L1298P probably damaging Het
Ocel1 A G 8: 71,372,753 E161G probably damaging Het
Olfr345 A T 2: 36,640,979 probably null Het
Pabpc2 A G 18: 39,774,828 Y382C probably benign Het
Pdhx A T 2: 103,042,296 V147D probably benign Het
Pigz A T 16: 31,945,333 H403L probably damaging Het
Pilra T C 5: 137,835,507 probably null Het
Rbm47 T C 5: 66,026,693 D189G probably damaging Het
Rhobtb2 A G 14: 69,794,002 L558P probably damaging Het
Scarf2 G A 16: 17,803,516 R322H probably damaging Het
Sept3 T C 15: 82,290,457 probably null Het
Sirt2 T C 7: 28,777,013 F26L probably damaging Het
Slc1a1 A T 19: 28,894,525 T133S probably benign Het
Slc1a2 A G 2: 102,737,869 I84V probably benign Het
Slc6a9 A T 4: 117,867,895 Q562L probably benign Het
Snx29 C T 16: 11,349,909 Q25* probably null Het
St6galnac6 A G 2: 32,618,543 I231V probably damaging Het
Stard9 A G 2: 120,696,123 T954A probably benign Het
Sufu A G 19: 46,483,630 M443V possibly damaging Het
Sv2b T C 7: 75,206,518 D8G probably benign Het
Tapbpl G A 6: 125,228,285 R233W probably damaging Het
Tex10 A G 4: 48,469,990 L25S probably benign Het
Trp53bp1 A T 2: 121,211,313 V1254D probably damaging Het
Ugt3a1 T A 15: 9,310,553 I307N probably benign Het
Unc13c T C 9: 73,931,844 D575G probably damaging Het
Usf2 A T 7: 30,954,772 D166E probably damaging Het
Usp25 T A 16: 77,114,989 L969M probably damaging Het
Usp32 G A 11: 84,994,393 P1276L probably damaging Het
Vmn2r8 T A 5: 108,808,581 E58D probably benign Het
Zfp462 G T 4: 55,011,598 C40F probably damaging Het
Other mutations in Panx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Panx1 APN 9 15007844 missense probably damaging 0.97
IGL01364:Panx1 APN 9 15021465 missense probably damaging 1.00
IGL02831:Panx1 APN 9 15007648 missense probably damaging 1.00
IGL02861:Panx1 APN 9 15007805 missense probably benign
cathedral UTSW 9 15007633 missense possibly damaging 0.53
elephant UTSW 9 15010217 missense probably damaging 1.00
notre_dame UTSW 9 15010217 missense probably damaging 1.00
R0422:Panx1 UTSW 9 15007816 nonsense probably null
R0602:Panx1 UTSW 9 15010204 missense probably damaging 1.00
R1509:Panx1 UTSW 9 15010045 missense possibly damaging 0.53
R1681:Panx1 UTSW 9 15007783 missense probably benign 0.13
R1862:Panx1 UTSW 9 15007428 missense probably damaging 1.00
R1895:Panx1 UTSW 9 15007526 missense probably benign 0.13
R1937:Panx1 UTSW 9 15007684 missense possibly damaging 0.68
R1946:Panx1 UTSW 9 15007526 missense probably benign 0.13
R2447:Panx1 UTSW 9 15044889 missense probably damaging 0.99
R3732:Panx1 UTSW 9 15006171 unclassified probably benign
R3732:Panx1 UTSW 9 15006171 unclassified probably benign
R3733:Panx1 UTSW 9 15006171 unclassified probably benign
R3734:Panx1 UTSW 9 15006171 unclassified probably benign
R3958:Panx1 UTSW 9 15006171 unclassified probably benign
R3960:Panx1 UTSW 9 15006171 unclassified probably benign
R4990:Panx1 UTSW 9 15010217 missense probably damaging 1.00
R5272:Panx1 UTSW 9 15044856 critical splice donor site probably null
R5556:Panx1 UTSW 9 15007633 missense possibly damaging 0.53
R5935:Panx1 UTSW 9 15010217 missense probably damaging 1.00
R6126:Panx1 UTSW 9 15007790 missense probably benign 0.38
R6683:Panx1 UTSW 9 15008011 missense probably benign 0.41
R6743:Panx1 UTSW 9 15007633 missense possibly damaging 0.53
R6873:Panx1 UTSW 9 15010217 missense probably damaging 1.00
R8061:Panx1 UTSW 9 15045001 missense possibly damaging 0.58
Z1177:Panx1 UTSW 9 15007814 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAATCTCGAGCACTCTTGGC -3'
(R):5'- ACCACTTCCTACCAGTTGATG -3'

Sequencing Primer
(F):5'- CACTCTTGGCAGCCTTGATGG -3'
(R):5'- CCTACCAGTTGATGTCTATTGAATGG -3'
Posted On2015-11-11