Incidental Mutation 'R4744:Agap2'
ID356591
Institutional Source Beutler Lab
Gene Symbol Agap2
Ensembl Gene ENSMUSG00000025422
Gene NameArfGAP with GTPase domain, ankyrin repeat and PH domain 2
SynonymsCentg1
MMRRC Submission 042027-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.333) question?
Stock #R4744 (G1)
Quality Score197
Status Validated
Chromosome10
Chromosomal Location127075284-127093169 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 127090203 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000043466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039259] [ENSMUST00000217941]
Predicted Effect probably null
Transcript: ENSMUST00000039259
SMART Domains Protein: ENSMUSP00000043466
Gene: ENSMUSG00000025422

DomainStartEndE-ValueType
low complexity region 28 44 N/A INTRINSIC
low complexity region 86 111 N/A INTRINSIC
low complexity region 112 135 N/A INTRINSIC
low complexity region 137 149 N/A INTRINSIC
low complexity region 151 176 N/A INTRINSIC
low complexity region 179 195 N/A INTRINSIC
low complexity region 197 207 N/A INTRINSIC
low complexity region 222 257 N/A INTRINSIC
low complexity region 306 322 N/A INTRINSIC
low complexity region 349 376 N/A INTRINSIC
Pfam:Ras 402 562 3.6e-16 PFAM
low complexity region 575 590 N/A INTRINSIC
low complexity region 600 609 N/A INTRINSIC
PH 671 906 4.35e-14 SMART
ArfGap 925 1045 8.8e-62 SMART
low complexity region 1052 1071 N/A INTRINSIC
ANK 1084 1113 1.15e0 SMART
ANK 1117 1145 3.69e2 SMART
low complexity region 1148 1175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217941
Meta Mutation Damage Score 0.9499 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the centaurin GTPase family. This gene product regulates the activity of multiple kinases, including PI3K. Reduced expression of this gene results in multiple defects, including neural deficiencies, while increased expression of this gene has been observed in some tumors. Alternative splicing results in multiple protein isoforms. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired lactation due to abnormal mammary gland growth during lactation, failure of insulin-suppressed gluconeogenesis, and hyperglycemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik T C 5: 114,879,556 S143P possibly damaging Het
4933427D14Rik T C 11: 72,175,539 K614E probably damaging Het
Aatk A G 11: 120,016,122 M155T possibly damaging Het
Acvr2b T C 9: 119,431,262 L333P probably damaging Het
Adam22 T C 5: 8,078,699 E865G probably damaging Het
Add2 A G 6: 86,110,888 S358G probably damaging Het
Alkbh8 G A 9: 3,344,604 W49* probably null Het
AU015228 A T 2: 130,100,629 noncoding transcript Het
Bank1 G T 3: 136,247,689 R102S probably benign Het
Brap T A 5: 121,662,130 D27E probably damaging Het
Cyb5r2 G T 7: 107,750,277 H276N possibly damaging Het
Dhh A G 15: 98,894,258 F290L possibly damaging Het
Dhrs7 T A 12: 72,652,251 N319I possibly damaging Het
Ebpl A G 14: 61,360,233 V53A probably damaging Het
Eif3j2 TGCCGCCGCCGCCGCCGCCGCCGCCGCC TGCCGCCGCCGCCGCCGCCGCCGCC 18: 43,477,717 probably benign Het
Etnk1 A C 6: 143,186,593 N220T probably damaging Het
F11r T A 1: 171,460,598 V64D probably benign Het
Fam171a1 T C 2: 3,224,909 S360P probably damaging Het
Fignl1 A G 11: 11,801,585 M490T probably damaging Het
Fpr-rs7 A T 17: 20,114,003 M75K probably benign Het
Fzd7 T A 1: 59,484,436 F493I possibly damaging Het
Galnt14 G T 17: 73,507,833 P412T probably damaging Het
Gcg T A 2: 62,478,631 S60C probably damaging Het
Ggt1 A G 10: 75,585,899 K527E probably benign Het
Gm14085 A T 2: 122,522,805 K489* probably null Het
Gm16551 T A 9: 74,850,871 noncoding transcript Het
Gm9972 A G 11: 43,036,690 K55E unknown Het
Gpr141 T A 13: 19,751,714 D297V probably benign Het
Grin2b G A 6: 135,778,699 S539L probably damaging Het
Hhipl1 A T 12: 108,319,979 N515I possibly damaging Het
Hmcn1 T G 1: 150,577,612 E5317D probably damaging Het
Hsf5 T A 11: 87,622,791 N227K probably benign Het
Igfn1 A T 1: 135,982,458 D129E probably benign Het
Invs T C 4: 48,397,609 F339L probably damaging Het
Jak2 T A 19: 29,262,256 S17T probably benign Het
Mdga2 T A 12: 66,797,727 I166F probably benign Het
Nck1 T C 9: 100,506,744 I6V probably benign Het
Neb T C 2: 52,150,577 D6624G probably benign Het
Nmur2 A G 11: 56,040,835 Y17H probably benign Het
Nwd2 T C 5: 63,806,967 L1298P probably damaging Het
Ocel1 A G 8: 71,372,753 E161G probably damaging Het
Olfr345 A T 2: 36,640,979 probably null Het
Pabpc2 A G 18: 39,774,828 Y382C probably benign Het
Panx1 A G 9: 15,010,298 probably benign Het
Pdhx A T 2: 103,042,296 V147D probably benign Het
Pigz A T 16: 31,945,333 H403L probably damaging Het
Pilra T C 5: 137,835,507 probably null Het
Rbm47 T C 5: 66,026,693 D189G probably damaging Het
Rhobtb2 A G 14: 69,794,002 L558P probably damaging Het
Scarf2 G A 16: 17,803,516 R322H probably damaging Het
Sept3 T C 15: 82,290,457 probably null Het
Sirt2 T C 7: 28,777,013 F26L probably damaging Het
Slc1a1 A T 19: 28,894,525 T133S probably benign Het
Slc1a2 A G 2: 102,737,869 I84V probably benign Het
Slc6a9 A T 4: 117,867,895 Q562L probably benign Het
Snx29 C T 16: 11,349,909 Q25* probably null Het
St6galnac6 A G 2: 32,618,543 I231V probably damaging Het
Stard9 A G 2: 120,696,123 T954A probably benign Het
Sufu A G 19: 46,483,630 M443V possibly damaging Het
Sv2b T C 7: 75,206,518 D8G probably benign Het
Tapbpl G A 6: 125,228,285 R233W probably damaging Het
Tex10 A G 4: 48,469,990 L25S probably benign Het
Trp53bp1 A T 2: 121,211,313 V1254D probably damaging Het
Ugt3a1 T A 15: 9,310,553 I307N probably benign Het
Unc13c T C 9: 73,931,844 D575G probably damaging Het
Usf2 A T 7: 30,954,772 D166E probably damaging Het
Usp25 T A 16: 77,114,989 L969M probably damaging Het
Usp32 G A 11: 84,994,393 P1276L probably damaging Het
Vmn2r8 T A 5: 108,808,581 E58D probably benign Het
Zfp462 G T 4: 55,011,598 C40F probably damaging Het
Other mutations in Agap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01385:Agap2 APN 10 127087996 missense unknown
IGL01690:Agap2 APN 10 127082958 splice site probably benign
IGL01765:Agap2 APN 10 127083235 missense unknown
IGL02029:Agap2 APN 10 127080283 missense unknown
IGL02525:Agap2 APN 10 127083201 splice site probably null
IGL03019:Agap2 APN 10 127091562 splice site probably benign
R0086:Agap2 UTSW 10 127087882 splice site probably null
R0197:Agap2 UTSW 10 127091702 missense possibly damaging 0.66
R0345:Agap2 UTSW 10 127087895 missense unknown
R0363:Agap2 UTSW 10 127090965 missense probably damaging 1.00
R0682:Agap2 UTSW 10 127083482 missense unknown
R0787:Agap2 UTSW 10 127085150 missense unknown
R0882:Agap2 UTSW 10 127087450 missense unknown
R0883:Agap2 UTSW 10 127091702 missense possibly damaging 0.66
R1445:Agap2 UTSW 10 127091112 splice site probably benign
R1800:Agap2 UTSW 10 127091671 missense probably damaging 1.00
R1854:Agap2 UTSW 10 127080516 missense unknown
R1925:Agap2 UTSW 10 127090875 missense probably damaging 1.00
R1986:Agap2 UTSW 10 127083044 nonsense probably null
R2050:Agap2 UTSW 10 127080261 nonsense probably null
R2267:Agap2 UTSW 10 127082428 splice site probably benign
R2269:Agap2 UTSW 10 127082428 splice site probably benign
R4174:Agap2 UTSW 10 127090514 missense probably damaging 0.98
R4397:Agap2 UTSW 10 127090483 missense unknown
R4418:Agap2 UTSW 10 127091650 missense probably damaging 1.00
R4472:Agap2 UTSW 10 127091213 missense probably damaging 1.00
R4612:Agap2 UTSW 10 127080096 missense unknown
R4690:Agap2 UTSW 10 127091375 missense possibly damaging 0.91
R5316:Agap2 UTSW 10 127082427 splice site probably null
R5533:Agap2 UTSW 10 127083042 missense unknown
R5680:Agap2 UTSW 10 127088011 missense unknown
R6010:Agap2 UTSW 10 127090910 missense probably damaging 1.00
R6276:Agap2 UTSW 10 127089360 critical splice donor site probably null
R6356:Agap2 UTSW 10 127082996 missense unknown
R7138:Agap2 UTSW 10 127087285 missense unknown
R7154:Agap2 UTSW 10 127091655 missense probably benign 0.34
R7497:Agap2 UTSW 10 127090965 missense probably damaging 0.99
R7718:Agap2 UTSW 10 127079865 missense possibly damaging 0.68
R7720:Agap2 UTSW 10 127091088 missense probably damaging 0.96
R7893:Agap2 UTSW 10 127080195 missense unknown
R7976:Agap2 UTSW 10 127080195 missense unknown
Z1088:Agap2 UTSW 10 127088242 missense unknown
Z1176:Agap2 UTSW 10 127080225 missense unknown
Predicted Primers PCR Primer
(F):5'- CAGACCTGCCTATTCTCACG -3'
(R):5'- AGTTCAAGCAGGAGGCCTTC -3'

Sequencing Primer
(F):5'- ACGGCTCTTGGCTTCCG -3'
(R):5'- GGAGGCCTTCCCCCAAAC -3'
Posted On2015-11-11