Incidental Mutation 'R4744:Usp32'
ID356596
Institutional Source Beutler Lab
Gene Symbol Usp32
Ensembl Gene ENSMUSG00000000804
Gene Nameubiquitin specific peptidase 32
Synonyms6430526O11Rik, 2900074J03Rik
MMRRC Submission 042027-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4744 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location84984442-85140161 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 84994393 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 1276 (P1276L)
Ref Sequence ENSEMBL: ENSMUSP00000103710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108075]
Predicted Effect probably benign
Transcript: ENSMUST00000000821
SMART Domains Protein: ENSMUSP00000000821
Gene: ENSMUSG00000000804

DomainStartEndE-ValueType
Pfam:UCH 32 260 4.1e-51 PFAM
Pfam:UCH_1 33 228 1.7e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108075
AA Change: P1276L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103710
Gene: ENSMUSG00000000804
AA Change: P1276L

DomainStartEndE-ValueType
EFh 232 260 4.66e0 SMART
EFh 268 296 5.8e-1 SMART
Blast:EFh 318 346 5e-7 BLAST
DUSP 389 588 2.32e-16 SMART
Pfam:Ubiquitin_3 628 711 2.4e-9 PFAM
Pfam:UCH 733 1564 2.4e-83 PFAM
Pfam:UCH_1 1202 1547 2.9e-12 PFAM
Meta Mutation Damage Score 0.6744 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 99% (82/83)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik T C 5: 114,879,556 S143P possibly damaging Het
4933427D14Rik T C 11: 72,175,539 K614E probably damaging Het
Aatk A G 11: 120,016,122 M155T possibly damaging Het
Acvr2b T C 9: 119,431,262 L333P probably damaging Het
Adam22 T C 5: 8,078,699 E865G probably damaging Het
Add2 A G 6: 86,110,888 S358G probably damaging Het
Agap2 T C 10: 127,090,203 probably null Het
Alkbh8 G A 9: 3,344,604 W49* probably null Het
AU015228 A T 2: 130,100,629 noncoding transcript Het
Bank1 G T 3: 136,247,689 R102S probably benign Het
Brap T A 5: 121,662,130 D27E probably damaging Het
Cyb5r2 G T 7: 107,750,277 H276N possibly damaging Het
Dhh A G 15: 98,894,258 F290L possibly damaging Het
Dhrs7 T A 12: 72,652,251 N319I possibly damaging Het
Ebpl A G 14: 61,360,233 V53A probably damaging Het
Eif3j2 TGCCGCCGCCGCCGCCGCCGCCGCCGCC TGCCGCCGCCGCCGCCGCCGCCGCC 18: 43,477,717 probably benign Het
Etnk1 A C 6: 143,186,593 N220T probably damaging Het
F11r T A 1: 171,460,598 V64D probably benign Het
Fam171a1 T C 2: 3,224,909 S360P probably damaging Het
Fignl1 A G 11: 11,801,585 M490T probably damaging Het
Fpr-rs7 A T 17: 20,114,003 M75K probably benign Het
Fzd7 T A 1: 59,484,436 F493I possibly damaging Het
Galnt14 G T 17: 73,507,833 P412T probably damaging Het
Gcg T A 2: 62,478,631 S60C probably damaging Het
Ggt1 A G 10: 75,585,899 K527E probably benign Het
Gm14085 A T 2: 122,522,805 K489* probably null Het
Gm16551 T A 9: 74,850,871 noncoding transcript Het
Gm9972 A G 11: 43,036,690 K55E unknown Het
Gpr141 T A 13: 19,751,714 D297V probably benign Het
Grin2b G A 6: 135,778,699 S539L probably damaging Het
Hhipl1 A T 12: 108,319,979 N515I possibly damaging Het
Hmcn1 T G 1: 150,577,612 E5317D probably damaging Het
Hsf5 T A 11: 87,622,791 N227K probably benign Het
Igfn1 A T 1: 135,982,458 D129E probably benign Het
Invs T C 4: 48,397,609 F339L probably damaging Het
Jak2 T A 19: 29,262,256 S17T probably benign Het
Mdga2 T A 12: 66,797,727 I166F probably benign Het
Nck1 T C 9: 100,506,744 I6V probably benign Het
Neb T C 2: 52,150,577 D6624G probably benign Het
Nmur2 A G 11: 56,040,835 Y17H probably benign Het
Nwd2 T C 5: 63,806,967 L1298P probably damaging Het
Ocel1 A G 8: 71,372,753 E161G probably damaging Het
Olfr345 A T 2: 36,640,979 probably null Het
Pabpc2 A G 18: 39,774,828 Y382C probably benign Het
Panx1 A G 9: 15,010,298 probably benign Het
Pdhx A T 2: 103,042,296 V147D probably benign Het
Pigz A T 16: 31,945,333 H403L probably damaging Het
Pilra T C 5: 137,835,507 probably null Het
Rbm47 T C 5: 66,026,693 D189G probably damaging Het
Rhobtb2 A G 14: 69,794,002 L558P probably damaging Het
Scarf2 G A 16: 17,803,516 R322H probably damaging Het
Sept3 T C 15: 82,290,457 probably null Het
Sirt2 T C 7: 28,777,013 F26L probably damaging Het
Slc1a1 A T 19: 28,894,525 T133S probably benign Het
Slc1a2 A G 2: 102,737,869 I84V probably benign Het
Slc6a9 A T 4: 117,867,895 Q562L probably benign Het
Snx29 C T 16: 11,349,909 Q25* probably null Het
St6galnac6 A G 2: 32,618,543 I231V probably damaging Het
Stard9 A G 2: 120,696,123 T954A probably benign Het
Sufu A G 19: 46,483,630 M443V possibly damaging Het
Sv2b T C 7: 75,206,518 D8G probably benign Het
Tapbpl G A 6: 125,228,285 R233W probably damaging Het
Tex10 A G 4: 48,469,990 L25S probably benign Het
Trp53bp1 A T 2: 121,211,313 V1254D probably damaging Het
Ugt3a1 T A 15: 9,310,553 I307N probably benign Het
Unc13c T C 9: 73,931,844 D575G probably damaging Het
Usf2 A T 7: 30,954,772 D166E probably damaging Het
Usp25 T A 16: 77,114,989 L969M probably damaging Het
Vmn2r8 T A 5: 108,808,581 E58D probably benign Het
Zfp462 G T 4: 55,011,598 C40F probably damaging Het
Other mutations in Usp32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00529:Usp32 APN 11 84994426 missense probably damaging 1.00
IGL00701:Usp32 APN 11 85059125 splice site probably null
IGL00848:Usp32 APN 11 85051181 splice site probably benign
IGL00934:Usp32 APN 11 85007076 missense probably damaging 1.00
IGL01019:Usp32 APN 11 85039265 missense probably damaging 0.97
IGL01302:Usp32 APN 11 84988482 missense probably benign 0.05
IGL01444:Usp32 APN 11 85059164 missense probably damaging 0.97
IGL01575:Usp32 APN 11 85022802 missense probably damaging 1.00
IGL01981:Usp32 APN 11 85036524 missense probably benign 0.02
IGL02118:Usp32 APN 11 85032177 nonsense probably null
IGL02159:Usp32 APN 11 85005802 splice site probably null
IGL02227:Usp32 APN 11 84986481 missense probably damaging 1.00
IGL02363:Usp32 APN 11 85044787 missense probably benign 0.01
IGL02524:Usp32 APN 11 85010011 nonsense probably null
IGL02613:Usp32 APN 11 85040070 missense probably damaging 0.99
IGL02720:Usp32 APN 11 85006991 critical splice donor site probably null
IGL02738:Usp32 APN 11 85083806 missense probably damaging 1.00
IGL02929:Usp32 APN 11 84988372 missense probably benign 0.01
IGL03303:Usp32 APN 11 85022832 missense probably damaging 1.00
PIT4812001:Usp32 UTSW 11 85010074 missense probably damaging 1.00
R0026:Usp32 UTSW 11 85032074 missense possibly damaging 0.48
R0295:Usp32 UTSW 11 85053692 missense probably damaging 0.98
R1320:Usp32 UTSW 11 85017793 missense probably damaging 0.98
R1712:Usp32 UTSW 11 85042580 missense probably benign 0.12
R1922:Usp32 UTSW 11 85007004 nonsense probably null
R1973:Usp32 UTSW 11 85103931 missense probably benign 0.09
R2010:Usp32 UTSW 11 85040004 missense probably damaging 0.98
R2082:Usp32 UTSW 11 85030512 missense probably damaging 0.99
R2355:Usp32 UTSW 11 85005909 missense probably benign 0.34
R3147:Usp32 UTSW 11 85029087 missense probably damaging 1.00
R3160:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3162:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3716:Usp32 UTSW 11 85042563 missense probably damaging 1.00
R3816:Usp32 UTSW 11 84994384 critical splice donor site probably null
R3870:Usp32 UTSW 11 85007055 nonsense probably null
R3871:Usp32 UTSW 11 85081156 missense probably null 0.81
R4041:Usp32 UTSW 11 85017739 missense probably benign 0.40
R4079:Usp32 UTSW 11 85039229 missense probably damaging 0.98
R4332:Usp32 UTSW 11 85103978 missense possibly damaging 0.79
R4396:Usp32 UTSW 11 85053975 missense probably benign
R4580:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4620:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4909:Usp32 UTSW 11 85055772 nonsense probably null
R5056:Usp32 UTSW 11 85026795 missense probably benign 0.07
R5111:Usp32 UTSW 11 85077331 missense possibly damaging 0.95
R5213:Usp32 UTSW 11 85022259 missense probably damaging 1.00
R5308:Usp32 UTSW 11 85017718 missense probably benign 0.12
R5381:Usp32 UTSW 11 85059127 critical splice donor site probably benign
R5538:Usp32 UTSW 11 85017786 missense possibly damaging 0.65
R5659:Usp32 UTSW 11 85077414 missense possibly damaging 0.94
R6006:Usp32 UTSW 11 84992451 critical splice donor site probably null
R6011:Usp32 UTSW 11 85032097 missense possibly damaging 0.70
R6029:Usp32 UTSW 11 85025582 missense probably damaging 0.99
R6074:Usp32 UTSW 11 84994573 missense probably benign 0.00
R6331:Usp32 UTSW 11 84986576 missense possibly damaging 0.92
R6353:Usp32 UTSW 11 85022281 missense probably benign
R6714:Usp32 UTSW 11 85026870 missense probably damaging 0.99
R6778:Usp32 UTSW 11 85025686 missense probably benign 0.00
R6988:Usp32 UTSW 11 85010143 missense probably benign 0.35
R6992:Usp32 UTSW 11 85032088 missense probably damaging 0.99
R7182:Usp32 UTSW 11 85040170 missense probably benign 0.34
R7186:Usp32 UTSW 11 85051234 missense probably benign 0.45
R7198:Usp32 UTSW 11 85022855 frame shift probably null
R7201:Usp32 UTSW 11 85022855 frame shift probably null
R7469:Usp32 UTSW 11 84988553 missense possibly damaging 0.94
R7502:Usp32 UTSW 11 85022898 missense possibly damaging 0.48
R7513:Usp32 UTSW 11 85027112 nonsense probably null
R7629:Usp32 UTSW 11 85019855 frame shift probably null
R7703:Usp32 UTSW 11 85077327 missense probably damaging 0.99
R7741:Usp32 UTSW 11 84987281 missense probably damaging 0.99
R7765:Usp32 UTSW 11 84994408 missense probably damaging 1.00
R7998:Usp32 UTSW 11 84994426 missense probably damaging 1.00
X0028:Usp32 UTSW 11 84992606 missense probably benign 0.05
Z1177:Usp32 UTSW 11 84988612 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTCTCACATTCTGGGATTAAAGGC -3'
(R):5'- GGTGTTCATTTTAAATGCCCTCAG -3'

Sequencing Primer
(F):5'- CACATTCTGGGATTAAAGGCATGTG -3'
(R):5'- CCCCCTCTAATAGGTTGTAGAGGAG -3'
Genotyping

Genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the mutation.

 

PCR Primers

R47440059_PCR_F: 5’- CTCTCACATTCTGGGATTAAAGGC-3’

R47440059_PCR_R: 5’- GGTGTTCATTTTAAATGCCCTCAG-3’

 

Sequencing Primers

R47440059_SEQ_F: 5’- CACATTCTGGGATTAAAGGCATGTG-3’
 

R47440059_SEQ_R: 5’- CCCCCTCTAATAGGTTGTAGAGGAG-3’
 

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               hold

 

The following sequence of 415 nucleotides is amplified (NCBI RefSeq: NC_000077, chromosome 11:84994222-84994636):

  

ctctcacatt ctgggattaa aggcatgtgc caccataccc aggtagaaaa gtttctaaac       

acagttatag gaaatacctt atcttcaaaa gtagccctga aatcctgcta atgactcctc      

taactcacac tagattcttc tcatagacag ggctattaac ataccaggat tggaggaagc      

ctccagaggt ccagtttctt ggttgccaaa cagtgtgttt tacatttgga gcagtagtac      

atctcatttt cccccagttc ctcctcactg gtgaaggcac ggagacagct gtccaggttg      

atgggctcag cttgtgctcg ccgactctgt tccacacttt catgctcctc tacaacctat      

tagaggggga aacaggatac acagagttgt gctgagggca tttaaaatga acacc

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (Chr. (+) = G>A).

Posted On2015-11-11