Incidental Mutation 'R4744:Scarf2'
ID356608
Institutional Source Beutler Lab
Gene Symbol Scarf2
Ensembl Gene ENSMUSG00000012017
Gene Namescavenger receptor class F, member 2
SynonymsSrec2, SREC-II
MMRRC Submission 042027-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4744 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location17797282-17808293 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 17803516 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 322 (R322H)
Ref Sequence ENSEMBL: ENSMUSP00000012161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012161] [ENSMUST00000232577]
Predicted Effect probably damaging
Transcript: ENSMUST00000012161
AA Change: R322H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000012161
Gene: ENSMUSG00000012017
AA Change: R322H

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
EGF 71 102 4.56e0 SMART
EGF 113 145 2.43e1 SMART
EGF 147 174 2.03e1 SMART
EGF_like 207 233 1.68e0 SMART
EGF 235 262 1.73e1 SMART
EGF_like 309 352 2.86e1 SMART
EGF_like 323 364 4.97e0 SMART
EGF_like 367 407 8.13e-1 SMART
low complexity region 437 459 N/A INTRINSIC
low complexity region 530 541 N/A INTRINSIC
low complexity region 565 577 N/A INTRINSIC
low complexity region 597 606 N/A INTRINSIC
low complexity region 616 632 N/A INTRINSIC
low complexity region 636 656 N/A INTRINSIC
low complexity region 665 685 N/A INTRINSIC
low complexity region 702 726 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231301
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231329
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231383
Predicted Effect probably damaging
Transcript: ENSMUST00000232577
AA Change: R322H

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
Meta Mutation Damage Score 0.1139 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to SCARF1/SREC-I, a scavenger receptor protein that mediates the binding and degradation of acetylated low density lipoprotein (Ac-LDL). This protein has only little activity of internalizing modified low density lipoproteins (LDL), but it can interact with SCARF1 through its extracellular domain. The association of this protein with SCARF1 is suppressed by the presence of scavenger ligands. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik T C 5: 114,879,556 S143P possibly damaging Het
4933427D14Rik T C 11: 72,175,539 K614E probably damaging Het
Aatk A G 11: 120,016,122 M155T possibly damaging Het
Acvr2b T C 9: 119,431,262 L333P probably damaging Het
Adam22 T C 5: 8,078,699 E865G probably damaging Het
Add2 A G 6: 86,110,888 S358G probably damaging Het
Agap2 T C 10: 127,090,203 probably null Het
Alkbh8 G A 9: 3,344,604 W49* probably null Het
AU015228 A T 2: 130,100,629 noncoding transcript Het
Bank1 G T 3: 136,247,689 R102S probably benign Het
Brap T A 5: 121,662,130 D27E probably damaging Het
Cyb5r2 G T 7: 107,750,277 H276N possibly damaging Het
Dhh A G 15: 98,894,258 F290L possibly damaging Het
Dhrs7 T A 12: 72,652,251 N319I possibly damaging Het
Ebpl A G 14: 61,360,233 V53A probably damaging Het
Eif3j2 TGCCGCCGCCGCCGCCGCCGCCGCCGCC TGCCGCCGCCGCCGCCGCCGCCGCC 18: 43,477,717 probably benign Het
Etnk1 A C 6: 143,186,593 N220T probably damaging Het
F11r T A 1: 171,460,598 V64D probably benign Het
Fam171a1 T C 2: 3,224,909 S360P probably damaging Het
Fignl1 A G 11: 11,801,585 M490T probably damaging Het
Fpr-rs7 A T 17: 20,114,003 M75K probably benign Het
Fzd7 T A 1: 59,484,436 F493I possibly damaging Het
Galnt14 G T 17: 73,507,833 P412T probably damaging Het
Gcg T A 2: 62,478,631 S60C probably damaging Het
Ggt1 A G 10: 75,585,899 K527E probably benign Het
Gm14085 A T 2: 122,522,805 K489* probably null Het
Gm16551 T A 9: 74,850,871 noncoding transcript Het
Gm9972 A G 11: 43,036,690 K55E unknown Het
Gpr141 T A 13: 19,751,714 D297V probably benign Het
Grin2b G A 6: 135,778,699 S539L probably damaging Het
Hhipl1 A T 12: 108,319,979 N515I possibly damaging Het
Hmcn1 T G 1: 150,577,612 E5317D probably damaging Het
Hsf5 T A 11: 87,622,791 N227K probably benign Het
Igfn1 A T 1: 135,982,458 D129E probably benign Het
Invs T C 4: 48,397,609 F339L probably damaging Het
Jak2 T A 19: 29,262,256 S17T probably benign Het
Mdga2 T A 12: 66,797,727 I166F probably benign Het
Nck1 T C 9: 100,506,744 I6V probably benign Het
Neb T C 2: 52,150,577 D6624G probably benign Het
Nmur2 A G 11: 56,040,835 Y17H probably benign Het
Nwd2 T C 5: 63,806,967 L1298P probably damaging Het
Ocel1 A G 8: 71,372,753 E161G probably damaging Het
Olfr345 A T 2: 36,640,979 probably null Het
Pabpc2 A G 18: 39,774,828 Y382C probably benign Het
Panx1 A G 9: 15,010,298 probably benign Het
Pdhx A T 2: 103,042,296 V147D probably benign Het
Pigz A T 16: 31,945,333 H403L probably damaging Het
Pilra T C 5: 137,835,507 probably null Het
Rbm47 T C 5: 66,026,693 D189G probably damaging Het
Rhobtb2 A G 14: 69,794,002 L558P probably damaging Het
Sept3 T C 15: 82,290,457 probably null Het
Sirt2 T C 7: 28,777,013 F26L probably damaging Het
Slc1a1 A T 19: 28,894,525 T133S probably benign Het
Slc1a2 A G 2: 102,737,869 I84V probably benign Het
Slc6a9 A T 4: 117,867,895 Q562L probably benign Het
Snx29 C T 16: 11,349,909 Q25* probably null Het
St6galnac6 A G 2: 32,618,543 I231V probably damaging Het
Stard9 A G 2: 120,696,123 T954A probably benign Het
Sufu A G 19: 46,483,630 M443V possibly damaging Het
Sv2b T C 7: 75,206,518 D8G probably benign Het
Tapbpl G A 6: 125,228,285 R233W probably damaging Het
Tex10 A G 4: 48,469,990 L25S probably benign Het
Trp53bp1 A T 2: 121,211,313 V1254D probably damaging Het
Ugt3a1 T A 15: 9,310,553 I307N probably benign Het
Unc13c T C 9: 73,931,844 D575G probably damaging Het
Usf2 A T 7: 30,954,772 D166E probably damaging Het
Usp25 T A 16: 77,114,989 L969M probably damaging Het
Usp32 G A 11: 84,994,393 P1276L probably damaging Het
Vmn2r8 T A 5: 108,808,581 E58D probably benign Het
Zfp462 G T 4: 55,011,598 C40F probably damaging Het
Other mutations in Scarf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01543:Scarf2 APN 16 17802549 missense probably damaging 1.00
IGL02166:Scarf2 APN 16 17803756 missense probably damaging 0.99
IGL02604:Scarf2 APN 16 17803744 missense probably damaging 0.97
IGL03155:Scarf2 APN 16 17807549 missense probably benign 0.00
R0639:Scarf2 UTSW 16 17806505 splice site probably null
R1703:Scarf2 UTSW 16 17802849 missense probably damaging 0.99
R2182:Scarf2 UTSW 16 17803022 missense probably damaging 1.00
R4730:Scarf2 UTSW 16 17803013 missense probably damaging 0.99
R4798:Scarf2 UTSW 16 17803507 missense probably damaging 1.00
R5521:Scarf2 UTSW 16 17803602 critical splice donor site probably null
R5994:Scarf2 UTSW 16 17806379 missense probably damaging 0.99
R6742:Scarf2 UTSW 16 17806487 missense probably damaging 1.00
R7264:Scarf2 UTSW 16 17803290 missense possibly damaging 0.63
R7286:Scarf2 UTSW 16 17802973 nonsense probably null
R7385:Scarf2 UTSW 16 17803838 missense probably damaging 1.00
R7409:Scarf2 UTSW 16 17807054 missense probably damaging 0.99
R7812:Scarf2 UTSW 16 17803828 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTATTGTCGCGAGCCATGC -3'
(R):5'- GCTGAAATGTAAGCCAAAGACC -3'

Sequencing Primer
(F):5'- ATGCCCCGCTGGATTCTATGG -3'
(R):5'- GACCACGAGGCCTACAGAG -3'
Posted On2015-11-11