Incidental Mutation 'R4744:Galnt14'
ID356612
Institutional Source Beutler Lab
Gene Symbol Galnt14
Ensembl Gene ENSMUSG00000024064
Gene Namepolypeptide N-acetylgalactosaminyltransferase 14
Synonyms0610033M06Rik
MMRRC Submission 042027-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R4744 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location73493228-73710453 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 73507833 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 412 (P412T)
Ref Sequence ENSEMBL: ENSMUSP00000108210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024858] [ENSMUST00000112591]
Predicted Effect probably benign
Transcript: ENSMUST00000024858
SMART Domains Protein: ENSMUSP00000024858
Gene: ENSMUSG00000024064

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 111 359 1.4e-10 PFAM
Pfam:Glycos_transf_2 114 294 7.5e-30 PFAM
Pfam:Glyco_tranf_2_2 114 333 1.5e-8 PFAM
Pfam:Glyco_transf_7C 271 340 7e-8 PFAM
RICIN 420 548 7.23e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112591
AA Change: P412T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108210
Gene: ENSMUSG00000024064
AA Change: P412T

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 111 359 1.1e-10 PFAM
Pfam:Glycos_transf_2 114 291 2.4e-27 PFAM
Pfam:Glyco_tranf_2_2 114 333 1.7e-8 PFAM
Pfam:Glyco_transf_7C 270 340 9e-8 PFAM
low complexity region 415 429 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Golgi protein which is a member of the polypeptide N-acetylgalactosaminyltransferase (ppGalNAc-Ts) protein family. These enzymes catalyze the transfer of N-acetyl-D-galactosamine (GalNAc) to the hydroxyl groups on serines and threonines in target peptides. The encoded protein has been shown to transfer GalNAc to large proteins like mucins. Alterations in this gene may play a role in cancer progression and response to chemotherapy. [provided by RefSeq, Jun 2016]
PHENOTYPE: Homozygous mutant mice exhibit enhanced motor coordination during inverted screen testing when compared with controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik T C 5: 114,879,556 S143P possibly damaging Het
4933427D14Rik T C 11: 72,175,539 K614E probably damaging Het
Aatk A G 11: 120,016,122 M155T possibly damaging Het
Acvr2b T C 9: 119,431,262 L333P probably damaging Het
Adam22 T C 5: 8,078,699 E865G probably damaging Het
Add2 A G 6: 86,110,888 S358G probably damaging Het
Agap2 T C 10: 127,090,203 probably null Het
Alkbh8 G A 9: 3,344,604 W49* probably null Het
AU015228 A T 2: 130,100,629 noncoding transcript Het
Bank1 G T 3: 136,247,689 R102S probably benign Het
Brap T A 5: 121,662,130 D27E probably damaging Het
Cyb5r2 G T 7: 107,750,277 H276N possibly damaging Het
Dhh A G 15: 98,894,258 F290L possibly damaging Het
Dhrs7 T A 12: 72,652,251 N319I possibly damaging Het
Ebpl A G 14: 61,360,233 V53A probably damaging Het
Eif3j2 TGCCGCCGCCGCCGCCGCCGCCGCCGCC TGCCGCCGCCGCCGCCGCCGCCGCC 18: 43,477,717 probably benign Het
Etnk1 A C 6: 143,186,593 N220T probably damaging Het
F11r T A 1: 171,460,598 V64D probably benign Het
Fam171a1 T C 2: 3,224,909 S360P probably damaging Het
Fignl1 A G 11: 11,801,585 M490T probably damaging Het
Fpr-rs7 A T 17: 20,114,003 M75K probably benign Het
Fzd7 T A 1: 59,484,436 F493I possibly damaging Het
Gcg T A 2: 62,478,631 S60C probably damaging Het
Ggt1 A G 10: 75,585,899 K527E probably benign Het
Gm14085 A T 2: 122,522,805 K489* probably null Het
Gm16551 T A 9: 74,850,871 noncoding transcript Het
Gm9972 A G 11: 43,036,690 K55E unknown Het
Gpr141 T A 13: 19,751,714 D297V probably benign Het
Grin2b G A 6: 135,778,699 S539L probably damaging Het
Hhipl1 A T 12: 108,319,979 N515I possibly damaging Het
Hmcn1 T G 1: 150,577,612 E5317D probably damaging Het
Hsf5 T A 11: 87,622,791 N227K probably benign Het
Igfn1 A T 1: 135,982,458 D129E probably benign Het
Invs T C 4: 48,397,609 F339L probably damaging Het
Jak2 T A 19: 29,262,256 S17T probably benign Het
Mdga2 T A 12: 66,797,727 I166F probably benign Het
Nck1 T C 9: 100,506,744 I6V probably benign Het
Neb T C 2: 52,150,577 D6624G probably benign Het
Nmur2 A G 11: 56,040,835 Y17H probably benign Het
Nwd2 T C 5: 63,806,967 L1298P probably damaging Het
Ocel1 A G 8: 71,372,753 E161G probably damaging Het
Olfr345 A T 2: 36,640,979 probably null Het
Pabpc2 A G 18: 39,774,828 Y382C probably benign Het
Panx1 A G 9: 15,010,298 probably benign Het
Pdhx A T 2: 103,042,296 V147D probably benign Het
Pigz A T 16: 31,945,333 H403L probably damaging Het
Pilra T C 5: 137,835,507 probably null Het
Rbm47 T C 5: 66,026,693 D189G probably damaging Het
Rhobtb2 A G 14: 69,794,002 L558P probably damaging Het
Scarf2 G A 16: 17,803,516 R322H probably damaging Het
Sept3 T C 15: 82,290,457 probably null Het
Sirt2 T C 7: 28,777,013 F26L probably damaging Het
Slc1a1 A T 19: 28,894,525 T133S probably benign Het
Slc1a2 A G 2: 102,737,869 I84V probably benign Het
Slc6a9 A T 4: 117,867,895 Q562L probably benign Het
Snx29 C T 16: 11,349,909 Q25* probably null Het
St6galnac6 A G 2: 32,618,543 I231V probably damaging Het
Stard9 A G 2: 120,696,123 T954A probably benign Het
Sufu A G 19: 46,483,630 M443V possibly damaging Het
Sv2b T C 7: 75,206,518 D8G probably benign Het
Tapbpl G A 6: 125,228,285 R233W probably damaging Het
Tex10 A G 4: 48,469,990 L25S probably benign Het
Trp53bp1 A T 2: 121,211,313 V1254D probably damaging Het
Ugt3a1 T A 15: 9,310,553 I307N probably benign Het
Unc13c T C 9: 73,931,844 D575G probably damaging Het
Usf2 A T 7: 30,954,772 D166E probably damaging Het
Usp25 T A 16: 77,114,989 L969M probably damaging Het
Usp32 G A 11: 84,994,393 P1276L probably damaging Het
Vmn2r8 T A 5: 108,808,581 E58D probably benign Het
Zfp462 G T 4: 55,011,598 C40F probably damaging Het
Other mutations in Galnt14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Galnt14 APN 17 73494232 missense probably damaging 1.00
IGL01295:Galnt14 APN 17 73504919 missense probably benign 0.01
IGL01578:Galnt14 APN 17 73535366 splice site probably benign
IGL01833:Galnt14 APN 17 73504904 missense probably benign
IGL02572:Galnt14 APN 17 73535267 missense probably damaging 1.00
IGL02890:Galnt14 APN 17 73509524 critical splice donor site probably null
IGL03145:Galnt14 APN 17 73504908 missense possibly damaging 0.63
IGL03175:Galnt14 APN 17 73522654 missense probably damaging 1.00
R0051:Galnt14 UTSW 17 73507859 missense probably benign 0.00
R0112:Galnt14 UTSW 17 73574984 splice site probably benign
R0167:Galnt14 UTSW 17 73522720 missense probably damaging 1.00
R0525:Galnt14 UTSW 17 73545081 missense probably damaging 1.00
R0675:Galnt14 UTSW 17 73545035 missense probably damaging 1.00
R1192:Galnt14 UTSW 17 73545138 splice site probably benign
R1335:Galnt14 UTSW 17 73526290 missense probably damaging 1.00
R1549:Galnt14 UTSW 17 73525313 missense possibly damaging 0.79
R1824:Galnt14 UTSW 17 73709939 missense probably benign 0.01
R2061:Galnt14 UTSW 17 73512153 missense probably damaging 1.00
R2259:Galnt14 UTSW 17 73494266 missense probably benign 0.00
R3844:Galnt14 UTSW 17 73709929 critical splice donor site probably null
R4257:Galnt14 UTSW 17 73504904 missense probably benign
R4364:Galnt14 UTSW 17 73512159 missense probably damaging 0.99
R4664:Galnt14 UTSW 17 73507813 intron probably benign
R4810:Galnt14 UTSW 17 73512121 missense probably damaging 0.99
R4840:Galnt14 UTSW 17 73504898 missense probably benign 0.01
R4846:Galnt14 UTSW 17 73536893 missense probably benign 0.19
R5328:Galnt14 UTSW 17 73505459 missense possibly damaging 0.46
R5507:Galnt14 UTSW 17 73495666 missense probably damaging 0.98
R5816:Galnt14 UTSW 17 73574882 missense probably damaging 1.00
R5872:Galnt14 UTSW 17 73574831 missense probably damaging 1.00
R5933:Galnt14 UTSW 17 73526305 missense probably benign 0.01
R6490:Galnt14 UTSW 17 73525370 missense probably damaging 0.98
R7117:Galnt14 UTSW 17 73494195 missense probably benign 0.00
R7128:Galnt14 UTSW 17 73545101 missense probably benign
R7451:Galnt14 UTSW 17 73574809 missense probably benign 0.00
R7604:Galnt14 UTSW 17 73504921 missense possibly damaging 0.94
R7786:Galnt14 UTSW 17 73709981 missense probably benign 0.00
X0067:Galnt14 UTSW 17 73509526 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GTGAGCAAAGCCACCTTAAAGG -3'
(R):5'- GATGCACCATTCATGCCTGC -3'

Sequencing Primer
(F):5'- TTTTAAGTCAAGGAGTAGGTGTAAAC -3'
(R):5'- ACATTTATCACATTCCCACAGTATGC -3'
Posted On2015-11-11