Incidental Mutation 'R4744:Slc1a1'
ID356615
Institutional Source Beutler Lab
Gene Symbol Slc1a1
Ensembl Gene ENSMUSG00000024935
Gene Namesolute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1
SynonymsD130048G10Rik, MEAAC1, EAAC1, EAAT3
MMRRC Submission 042027-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4744 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location28835049-28913960 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28894525 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 133 (T133S)
Ref Sequence ENSEMBL: ENSMUSP00000025875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025875] [ENSMUST00000179171]
Predicted Effect probably benign
Transcript: ENSMUST00000025875
AA Change: T133S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025875
Gene: ENSMUSG00000024935
AA Change: T133S

DomainStartEndE-ValueType
Pfam:SDF 20 464 2.3e-135 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160702
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161119
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162189
Predicted Effect probably benign
Transcript: ENSMUST00000179171
SMART Domains Protein: ENSMUSP00000137486
Gene: ENSMUSG00000064202

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
Meta Mutation Damage Score 0.1139 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the high-affinity glutamate transporters that play an essential role in transporting glutamate across plasma membranes. In brain, these transporters are crucial in terminating the postsynaptic action of the neurotransmitter glutamate, and in maintaining extracellular glutamate concentrations below neurotoxic levels. This transporter also transports aspartate, and mutations in this gene are thought to cause dicarboxylicamino aciduria, also known as glutamate-aspartate transport defect. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene display reduced locomotor activity and excessive excretion of glutamate and aspartate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik T C 5: 114,879,556 S143P possibly damaging Het
4933427D14Rik T C 11: 72,175,539 K614E probably damaging Het
Aatk A G 11: 120,016,122 M155T possibly damaging Het
Acvr2b T C 9: 119,431,262 L333P probably damaging Het
Adam22 T C 5: 8,078,699 E865G probably damaging Het
Add2 A G 6: 86,110,888 S358G probably damaging Het
Agap2 T C 10: 127,090,203 probably null Het
Alkbh8 G A 9: 3,344,604 W49* probably null Het
AU015228 A T 2: 130,100,629 noncoding transcript Het
Bank1 G T 3: 136,247,689 R102S probably benign Het
Brap T A 5: 121,662,130 D27E probably damaging Het
Cyb5r2 G T 7: 107,750,277 H276N possibly damaging Het
Dhh A G 15: 98,894,258 F290L possibly damaging Het
Dhrs7 T A 12: 72,652,251 N319I possibly damaging Het
Ebpl A G 14: 61,360,233 V53A probably damaging Het
Eif3j2 TGCCGCCGCCGCCGCCGCCGCCGCCGCC TGCCGCCGCCGCCGCCGCCGCCGCC 18: 43,477,717 probably benign Het
Etnk1 A C 6: 143,186,593 N220T probably damaging Het
F11r T A 1: 171,460,598 V64D probably benign Het
Fam171a1 T C 2: 3,224,909 S360P probably damaging Het
Fignl1 A G 11: 11,801,585 M490T probably damaging Het
Fpr-rs7 A T 17: 20,114,003 M75K probably benign Het
Fzd7 T A 1: 59,484,436 F493I possibly damaging Het
Galnt14 G T 17: 73,507,833 P412T probably damaging Het
Gcg T A 2: 62,478,631 S60C probably damaging Het
Ggt1 A G 10: 75,585,899 K527E probably benign Het
Gm14085 A T 2: 122,522,805 K489* probably null Het
Gm16551 T A 9: 74,850,871 noncoding transcript Het
Gm9972 A G 11: 43,036,690 K55E unknown Het
Gpr141 T A 13: 19,751,714 D297V probably benign Het
Grin2b G A 6: 135,778,699 S539L probably damaging Het
Hhipl1 A T 12: 108,319,979 N515I possibly damaging Het
Hmcn1 T G 1: 150,577,612 E5317D probably damaging Het
Hsf5 T A 11: 87,622,791 N227K probably benign Het
Igfn1 A T 1: 135,982,458 D129E probably benign Het
Invs T C 4: 48,397,609 F339L probably damaging Het
Jak2 T A 19: 29,262,256 S17T probably benign Het
Mdga2 T A 12: 66,797,727 I166F probably benign Het
Nck1 T C 9: 100,506,744 I6V probably benign Het
Neb T C 2: 52,150,577 D6624G probably benign Het
Nmur2 A G 11: 56,040,835 Y17H probably benign Het
Nwd2 T C 5: 63,806,967 L1298P probably damaging Het
Ocel1 A G 8: 71,372,753 E161G probably damaging Het
Olfr345 A T 2: 36,640,979 probably null Het
Pabpc2 A G 18: 39,774,828 Y382C probably benign Het
Panx1 A G 9: 15,010,298 probably benign Het
Pdhx A T 2: 103,042,296 V147D probably benign Het
Pigz A T 16: 31,945,333 H403L probably damaging Het
Pilra T C 5: 137,835,507 probably null Het
Rbm47 T C 5: 66,026,693 D189G probably damaging Het
Rhobtb2 A G 14: 69,794,002 L558P probably damaging Het
Scarf2 G A 16: 17,803,516 R322H probably damaging Het
Sept3 T C 15: 82,290,457 probably null Het
Sirt2 T C 7: 28,777,013 F26L probably damaging Het
Slc1a2 A G 2: 102,737,869 I84V probably benign Het
Slc6a9 A T 4: 117,867,895 Q562L probably benign Het
Snx29 C T 16: 11,349,909 Q25* probably null Het
St6galnac6 A G 2: 32,618,543 I231V probably damaging Het
Stard9 A G 2: 120,696,123 T954A probably benign Het
Sufu A G 19: 46,483,630 M443V possibly damaging Het
Sv2b T C 7: 75,206,518 D8G probably benign Het
Tapbpl G A 6: 125,228,285 R233W probably damaging Het
Tex10 A G 4: 48,469,990 L25S probably benign Het
Trp53bp1 A T 2: 121,211,313 V1254D probably damaging Het
Ugt3a1 T A 15: 9,310,553 I307N probably benign Het
Unc13c T C 9: 73,931,844 D575G probably damaging Het
Usf2 A T 7: 30,954,772 D166E probably damaging Het
Usp25 T A 16: 77,114,989 L969M probably damaging Het
Usp32 G A 11: 84,994,393 P1276L probably damaging Het
Vmn2r8 T A 5: 108,808,581 E58D probably benign Het
Zfp462 G T 4: 55,011,598 C40F probably damaging Het
Other mutations in Slc1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02170:Slc1a1 APN 19 28902753 missense possibly damaging 0.66
IGL02726:Slc1a1 APN 19 28911769 missense probably benign 0.04
IGL02865:Slc1a1 APN 19 28905338 missense probably damaging 1.00
R0008:Slc1a1 UTSW 19 28901484 missense probably benign 0.01
R0008:Slc1a1 UTSW 19 28901484 missense probably benign 0.01
R0490:Slc1a1 UTSW 19 28897531 missense probably benign
R1219:Slc1a1 UTSW 19 28904746 splice site probably benign
R1333:Slc1a1 UTSW 19 28835211 start gained probably benign
R1623:Slc1a1 UTSW 19 28904722 missense probably benign 0.09
R1669:Slc1a1 UTSW 19 28911794 missense probably benign 0.04
R1746:Slc1a1 UTSW 19 28894469 missense probably benign 0.31
R2516:Slc1a1 UTSW 19 28892912 missense probably benign 0.31
R4198:Slc1a1 UTSW 19 28901452 missense probably benign 0.00
R4199:Slc1a1 UTSW 19 28901452 missense probably benign 0.00
R4200:Slc1a1 UTSW 19 28901452 missense probably benign 0.00
R4432:Slc1a1 UTSW 19 28902709 missense probably benign 0.21
R5110:Slc1a1 UTSW 19 28911808 missense probably benign 0.14
R5341:Slc1a1 UTSW 19 28897568 missense probably benign
R6136:Slc1a1 UTSW 19 28905410 missense probably damaging 1.00
R6153:Slc1a1 UTSW 19 28909535 missense probably damaging 0.98
R6640:Slc1a1 UTSW 19 28894570 critical splice donor site probably null
RF020:Slc1a1 UTSW 19 28879155 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGATTGCCTGCATCACCTTGTC -3'
(R):5'- GGCAAATAGAGAGTCCTGGC -3'

Sequencing Primer
(F):5'- GTCATCTGCTTCTCCAAAGGC -3'
(R):5'- GGATCTGAGTTCAAATCCCCATG -3'
Posted On2015-11-11