Incidental Mutation 'R0403:Atrn'
ID35663
Institutional Source Beutler Lab
Gene Symbol Atrn
Ensembl Gene ENSMUSG00000027312
Gene Nameattractin
SynonymsMgca
MMRRC Submission 038608-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0403 (G1)
Quality Score150
Status Validated
Chromosome2
Chromosomal Location130906495-131030333 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 130906859 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 100 (C100Y)
Ref Sequence ENSEMBL: ENSMUSP00000028781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028781] [ENSMUST00000146975]
Predicted Effect probably damaging
Transcript: ENSMUST00000028781
AA Change: C100Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028781
Gene: ENSMUSG00000027312
AA Change: C100Y

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 51 97 N/A INTRINSIC
EGF 99 129 9.85e-5 SMART
CUB 131 247 7.85e-18 SMART
EGF 248 282 1.47e1 SMART
Pfam:Kelch_1 339 382 1.1e-7 PFAM
Pfam:Kelch_5 389 434 2.5e-7 PFAM
Pfam:Kelch_6 390 439 3.3e-8 PFAM
Pfam:Kelch_1 553 606 8.4e-8 PFAM
PSI 646 693 7.41e-7 SMART
PSI 702 747 8.64e-8 SMART
PSI 754 799 2.11e-2 SMART
CLECT 787 918 6.14e-20 SMART
PSI 931 982 1.11e-5 SMART
PSI 985 1060 1.2e-6 SMART
EGF_Lam 1062 1105 1.97e-4 SMART
EGF_like 1108 1154 3.9e0 SMART
transmembrane domain 1278 1300 N/A INTRINSIC
low complexity region 1310 1322 N/A INTRINSIC
low complexity region 1373 1385 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128176
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133766
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134964
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135110
Predicted Effect probably benign
Transcript: ENSMUST00000146975
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156982
Meta Mutation Damage Score 0.9251 question?
Coding Region Coverage
  • 1x: 98.0%
  • 3x: 96.8%
  • 10x: 93.2%
  • 20x: 83.7%
Validation Efficiency 97% (110/113)
MGI Phenotype FUNCTION: This gene encodes a widely expressed transmembrane glycoprotein that plays important roles in diverse physiological processes such as regulation of hair pigmentation, monocyte-T cell interaction and control of energy homeostasis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the mahogany mouse phenotype of dark brown or black coat on a normally agouti background. Mice with loss-of-function mutations in this gene exhibit black coat color, tremor, adiposity, higher basal metabolic rate, juvenile-onset hypomyelination and age-dependent spongiform neurodegeneration of the central nervous system. [provided by RefSeq, Jul 2016]
PHENOTYPE: Some mutant homozygotes exhibit decreases in phaeomelanin synthesis, body weight, and adiposity; increases in locomotion, and abnormal myelination and vacuolation of the central nervous system resulting in tremors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace A G 11: 105,973,880 probably null Het
Adgrg3 C T 8: 95,036,922 L284F probably benign Het
Alkbh8 T A 9: 3,385,469 V587E probably damaging Het
Ap4b1 T A 3: 103,818,839 C244S probably damaging Het
Ap4b1 T A 3: 103,821,396 M590K probably benign Het
Arhgap15 C T 2: 44,063,766 T168I probably damaging Het
Arntl2 T A 6: 146,822,655 H348Q probably damaging Het
Atp8b1 A G 18: 64,540,310 V997A probably damaging Het
Baiap2l2 C A 15: 79,271,216 A151S probably benign Het
Baz2b A T 2: 59,969,377 D199E possibly damaging Het
Cblb A G 16: 52,152,626 D440G probably benign Het
Cdon T C 9: 35,473,500 V694A probably benign Het
Cep250 A T 2: 155,992,349 R2065W probably damaging Het
Ces2b G T 8: 104,833,945 A131S probably damaging Het
Chrna9 A T 5: 65,967,892 T59S possibly damaging Het
Cog3 T A 14: 75,742,327 probably benign Het
Cpa1 G A 6: 30,641,857 V227I probably benign Het
Cyp3a25 A T 5: 145,998,513 C98S probably damaging Het
D8Ertd738e C T 8: 84,249,601 probably null Het
Ddx60 A G 8: 61,994,541 probably benign Het
Dhx16 T C 17: 35,883,050 probably null Het
Dnah9 T A 11: 66,084,789 Q1478L possibly damaging Het
Dock10 T C 1: 80,524,070 Y1434C possibly damaging Het
Enpp3 T A 10: 24,804,436 D325V probably damaging Het
Entpd6 C A 2: 150,760,170 T194K possibly damaging Het
Fam208b A T 13: 3,582,052 Y816* probably null Het
Fat2 A T 11: 55,270,349 V3185E probably benign Het
Flrt1 A G 19: 7,095,919 L421P probably benign Het
Fmn2 A T 1: 174,694,278 Q1292L probably damaging Het
Fndc1 T C 17: 7,775,588 probably null Het
Fndc1 T C 17: 7,753,723 D1459G probably damaging Het
Fzr1 A G 10: 81,369,368 S265P possibly damaging Het
Gm13119 A G 4: 144,362,646 N178S probably benign Het
Gm14085 T C 2: 122,521,854 L364S probably damaging Het
Gpr142 G A 11: 114,806,029 V134M probably damaging Het
Grid2ip G T 5: 143,357,620 V24L possibly damaging Het
Herc2 G A 7: 56,159,417 R2555H probably damaging Het
Hpdl A T 4: 116,820,479 Y262N possibly damaging Het
Htr3a A G 9: 48,908,659 V57A probably damaging Het
Igfbp7 T C 5: 77,355,591 I186V probably benign Het
Itga2b C T 11: 102,467,326 probably null Het
Itgae A C 11: 73,123,183 D736A possibly damaging Het
Itpkc T A 7: 27,208,345 M645L probably benign Het
Jchain T C 5: 88,521,378 R139G probably benign Het
Kif13a A G 13: 46,791,401 V908A probably damaging Het
Kif1b T A 4: 149,181,967 K389* probably null Het
Klhl12 T C 1: 134,485,856 Y360H possibly damaging Het
Knop1 G A 7: 118,853,053 R148W probably damaging Het
Lpar1 T A 4: 58,487,191 N27Y probably damaging Het
Lpar2 T A 8: 69,824,152 V197D probably damaging Het
Lrrc74a A G 12: 86,740,979 N128S probably damaging Het
Lum G T 10: 97,572,043 V337F probably benign Het
Mag T C 7: 30,906,980 D344G probably damaging Het
Maip1 G A 1: 57,407,196 A142T probably benign Het
Mlh3 A G 12: 85,268,968 V148A possibly damaging Het
Nav3 A G 10: 109,767,103 V1195A probably damaging Het
Ncor2 A G 5: 125,033,337 S868P possibly damaging Het
Nek1 A G 8: 61,106,855 E907G probably damaging Het
Nfam1 G A 15: 83,016,379 T134I probably benign Het
Nr0b2 T C 4: 133,553,759 V112A probably damaging Het
Nrp1 A G 8: 128,457,969 N365S probably damaging Het
Nrsn2 T C 2: 152,369,790 Y107C probably damaging Het
Ntng1 G A 3: 109,934,611 A282V probably damaging Het
Nxf1 T C 19: 8,765,028 I337T probably damaging Het
Obscn C T 11: 59,076,540 G479D probably damaging Het
Olfr45 T C 7: 140,691,309 S135P possibly damaging Het
Oprd1 T A 4: 132,113,768 D293V probably benign Het
P3h2 T G 16: 25,969,950 N586H possibly damaging Het
Pcid2 T C 8: 13,085,367 Y214C probably damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pkd1l3 G A 8: 109,623,663 S380N probably benign Het
Ppic C A 18: 53,411,071 G81W probably damaging Het
Ppp2r1a C A 17: 20,957,041 P246T probably damaging Het
Ppp4r4 T G 12: 103,584,102 S46A probably benign Het
Prkce A G 17: 86,168,653 T21A probably damaging Het
Prkg2 T C 5: 98,994,645 E210G possibly damaging Het
Prss35 A G 9: 86,756,037 M287V probably damaging Het
Psd G A 19: 46,320,972 probably benign Het
Ptch2 A T 4: 117,110,839 K843* probably null Het
Rab44 C A 17: 29,145,261 T603K probably damaging Het
Rasal3 T A 17: 32,392,790 probably null Het
Rbbp6 A G 7: 122,992,296 T526A probably damaging Het
Ros1 A T 10: 52,143,438 probably benign Het
Sec24b T A 3: 129,989,676 L1104F possibly damaging Het
Sec24b A G 3: 129,999,534 S685P probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Setmar A T 6: 108,075,962 H139L probably benign Het
Slc4a7 T C 14: 14,766,808 V710A probably benign Het
Smarcc1 T A 9: 110,237,808 probably null Het
Smchd1 G A 17: 71,394,902 L1032F probably damaging Het
Speg T C 1: 75,430,784 probably benign Het
Tcea1 C G 1: 4,889,503 R134G probably benign Het
Tchhl1 C T 3: 93,471,029 Q347* probably null Het
Tecrl A T 5: 83,354,758 probably benign Het
Tepsin T C 11: 120,093,682 probably benign Het
Tmem40 G A 6: 115,733,985 probably benign Het
Tpr G A 1: 150,407,414 probably benign Het
Ttll12 A T 15: 83,580,658 probably benign Het
Ttn T A 2: 76,909,608 D3529V probably benign Het
Usp34 T A 11: 23,333,838 H177Q possibly damaging Het
Vsig10 T A 5: 117,338,461 S327T probably benign Het
Zbtb4 T A 11: 69,777,639 M396K probably damaging Het
Zfp352 C T 4: 90,225,009 T462I possibly damaging Het
Zfp385b T C 2: 77,476,845 M145V probably damaging Het
Zfp780b C A 7: 27,971,689 V65F possibly damaging Het
Other mutations in Atrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Atrn APN 2 130958079 missense probably damaging 1.00
IGL00571:Atrn APN 2 130995048 missense probably damaging 1.00
IGL01092:Atrn APN 2 130947636 nonsense probably null
IGL01572:Atrn APN 2 131002795 missense probably damaging 1.00
IGL01924:Atrn APN 2 130935565 missense probably damaging 1.00
IGL02116:Atrn APN 2 130958089 missense probably damaging 1.00
IGL02372:Atrn APN 2 131002754 splice site probably benign
IGL02390:Atrn APN 2 131020977 missense possibly damaging 0.82
IGL02548:Atrn APN 2 130972282 missense probably damaging 1.00
IGL02749:Atrn APN 2 130970144 nonsense probably null
IGL02749:Atrn APN 2 130947734 splice site probably benign
R0026:Atrn UTSW 2 130957920 missense probably damaging 1.00
R0479:Atrn UTSW 2 130999165 nonsense probably null
R0544:Atrn UTSW 2 130986826 missense probably damaging 1.00
R0570:Atrn UTSW 2 130980134 missense probably benign 0.01
R0606:Atrn UTSW 2 130906856 missense possibly damaging 0.90
R0617:Atrn UTSW 2 130995085 critical splice donor site probably null
R0658:Atrn UTSW 2 130970227 critical splice donor site probably null
R1108:Atrn UTSW 2 130957914 missense probably damaging 1.00
R1112:Atrn UTSW 2 130999161 missense probably benign 0.04
R1219:Atrn UTSW 2 131021007 missense possibly damaging 0.90
R1422:Atrn UTSW 2 130957914 missense probably damaging 1.00
R1524:Atrn UTSW 2 130957080 missense probably benign 0.15
R1653:Atrn UTSW 2 130935624 missense probably benign
R1795:Atrn UTSW 2 130972288 missense probably benign
R1807:Atrn UTSW 2 130982772 missense possibly damaging 0.94
R1920:Atrn UTSW 2 130995051 missense probably damaging 1.00
R1921:Atrn UTSW 2 130995051 missense probably damaging 1.00
R1935:Atrn UTSW 2 130958035 missense probably damaging 1.00
R1982:Atrn UTSW 2 130970222 missense probably benign
R2000:Atrn UTSW 2 130935588 missense probably damaging 1.00
R2143:Atrn UTSW 2 130957996 missense probably benign 0.03
R2336:Atrn UTSW 2 130957954 missense probably damaging 1.00
R2679:Atrn UTSW 2 130961675 critical splice donor site probably null
R3426:Atrn UTSW 2 131020956 missense probably benign 0.06
R3909:Atrn UTSW 2 130994207 missense probably damaging 1.00
R4077:Atrn UTSW 2 130964930 critical splice donor site probably null
R4162:Atrn UTSW 2 130994228 splice site probably benign
R4195:Atrn UTSW 2 130933412 missense probably damaging 1.00
R4364:Atrn UTSW 2 130970208 missense probably benign 0.39
R4465:Atrn UTSW 2 130960468 missense probably benign 0.08
R4510:Atrn UTSW 2 130935577 nonsense probably null
R4511:Atrn UTSW 2 130935577 nonsense probably null
R4527:Atrn UTSW 2 130973504 missense probably benign 0.10
R4586:Atrn UTSW 2 130982042 missense probably damaging 1.00
R4592:Atrn UTSW 2 130999130 intron probably benign
R4658:Atrn UTSW 2 130933429 missense probably damaging 1.00
R4735:Atrn UTSW 2 131020990 missense probably benign 0.06
R4960:Atrn UTSW 2 130995047 nonsense probably null
R4999:Atrn UTSW 2 130975954 missense probably damaging 1.00
R5066:Atrn UTSW 2 130994193 missense possibly damaging 0.60
R5080:Atrn UTSW 2 130970124 missense possibly damaging 0.95
R5141:Atrn UTSW 2 130999130 intron probably benign
R5256:Atrn UTSW 2 130946019 missense probably benign 0.39
R5494:Atrn UTSW 2 131023075 missense probably damaging 1.00
R5678:Atrn UTSW 2 130970016 missense probably damaging 0.96
R5752:Atrn UTSW 2 130906544 unclassified probably benign
R5931:Atrn UTSW 2 130933436 missense possibly damaging 0.56
R6023:Atrn UTSW 2 131020980 missense probably benign 0.25
R6176:Atrn UTSW 2 130946091 missense probably benign 0.31
R6377:Atrn UTSW 2 130979969 missense probably damaging 1.00
R6433:Atrn UTSW 2 131023027 missense probably damaging 1.00
R7226:Atrn UTSW 2 130986744 missense probably damaging 0.99
R7402:Atrn UTSW 2 130947600 missense probably damaging 1.00
R7541:Atrn UTSW 2 130961571 missense possibly damaging 0.46
R7587:Atrn UTSW 2 130980114 missense probably damaging 1.00
R7872:Atrn UTSW 2 130970227 critical splice donor site probably null
R7910:Atrn UTSW 2 130964887 missense probably benign 0.04
R7913:Atrn UTSW 2 130970211 missense probably damaging 1.00
R7955:Atrn UTSW 2 130970227 critical splice donor site probably null
R7991:Atrn UTSW 2 130964887 missense probably benign 0.04
R7994:Atrn UTSW 2 130970211 missense probably damaging 1.00
R8044:Atrn UTSW 2 130935529 missense probably damaging 1.00
RF009:Atrn UTSW 2 130906922 missense probably benign 0.12
X0024:Atrn UTSW 2 130958139 missense probably damaging 1.00
Z1088:Atrn UTSW 2 130973399 missense probably benign
Z1176:Atrn UTSW 2 130946193 missense probably benign 0.27
Z1177:Atrn UTSW 2 130946042 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAGGCGATGTTCATCCGCGCTAAG -3'
(R):5'- AGCCATCATCAAACACAGTGGGG -3'

Sequencing Primer
(F):5'- AAGATggtggcggtggc -3'
(R):5'- ACAGTGGGGCAAATTCTACC -3'
Posted On2013-05-09