Incidental Mutation 'R4745:Hfm1'
ID356635
Institutional Source Beutler Lab
Gene Symbol Hfm1
Ensembl Gene ENSMUSG00000043410
Gene NameHFM1, ATP-dependent DNA helicase homolog
SynonymsLOC381663, A330009G12Rik, Mer3, Sec63d1
MMRRC Submission 042028-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R4745 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location106840192-106926321 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 106901843 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 417 (D417E)
Ref Sequence ENSEMBL: ENSMUSP00000112590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112690] [ENSMUST00000117588] [ENSMUST00000148686] [ENSMUST00000200249]
Predicted Effect possibly damaging
Transcript: ENSMUST00000112690
AA Change: D417E

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108310
Gene: ENSMUSG00000043410
AA Change: D417E

DomainStartEndE-ValueType
DEXDc 276 490 3.66e-29 SMART
HELICc 571 657 1.56e-14 SMART
low complexity region 751 764 N/A INTRINSIC
Sec63 775 1090 5.66e-60 SMART
Blast:Sec63 1130 1188 2e-18 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000117588
AA Change: D417E

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112590
Gene: ENSMUSG00000043410
AA Change: D417E

DomainStartEndE-ValueType
DEXDc 276 490 3.66e-29 SMART
HELICc 571 657 1.56e-14 SMART
low complexity region 751 764 N/A INTRINSIC
Sec63 775 1090 5.66e-60 SMART
Blast:Sec63 1130 1188 2e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134292
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137795
Predicted Effect probably benign
Transcript: ENSMUST00000148686
Predicted Effect probably benign
Transcript: ENSMUST00000200249
SMART Domains Protein: ENSMUSP00000142727
Gene: ENSMUSG00000043410

DomainStartEndE-ValueType
Pfam:ResIII 260 410 9.9e-7 PFAM
Pfam:DEAD 281 410 1.5e-19 PFAM
Meta Mutation Damage Score 0.1023 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (89/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be an ATP-dependent DNA helicase and is expressed mainly in germ-line cells. Defects in this gene are a cause of premature ovarian failure 9 (POF9). [provided by RefSeq, Apr 2014]
PHENOTYPE: Meiosis ais disrupted in homozygotes and bothe sexes are sterile [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,307,453 Y619C probably damaging Het
Adck1 A G 12: 88,402,179 probably null Het
Agap3 A C 5: 24,451,125 probably null Het
Ankib1 A T 5: 3,732,566 H354Q probably damaging Het
Ankrd29 T G 18: 12,254,622 N301T probably benign Het
Arhgef4 A G 1: 34,807,275 T379A probably damaging Het
Arid1a A G 4: 133,753,106 V169A probably benign Het
Armc4 G A 18: 7,286,763 T156M probably benign Het
Bag2 T C 1: 33,748,336 probably null Het
Bmt2 A C 6: 13,628,687 Y332* probably null Het
Bpifb1 A T 2: 154,211,581 K248* probably null Het
Caap1 C A 4: 94,556,514 probably null Het
Calcr T A 6: 3,692,576 Y389F probably damaging Het
Capn1 C T 19: 5,993,916 V562I probably benign Het
Ccr1 T A 9: 123,963,948 T182S probably benign Het
Ceacam15 T C 7: 16,673,334 D86G probably benign Het
Cldnd1 C T 16: 58,729,643 T63I probably benign Het
Col12a1 A T 9: 79,652,086 probably null Het
Cystm1 A G 18: 36,393,295 probably benign Het
Ddx55 T A 5: 124,566,965 Y428* probably null Het
Ensa G A 3: 95,631,434 G118D probably benign Het
Fam208b G A 13: 3,590,069 T356I probably benign Het
Folh1 A T 7: 86,723,274 probably null Het
Foxj2 C A 6: 122,837,989 P328Q probably damaging Het
Fscn3 A G 6: 28,435,628 I417V probably damaging Het
Galnt7 T C 8: 57,542,727 probably benign Het
Gm11563 T A 11: 99,658,420 *169C probably null Het
Ighv15-2 A G 12: 114,564,610 S107P probably damaging Het
Itsn2 A G 12: 4,661,944 D904G probably damaging Het
Kif1b A T 4: 149,237,882 L860* probably null Het
Krt79 T C 15: 101,930,684 E450G probably damaging Het
Lama1 T C 17: 67,738,780 S227P probably damaging Het
Lamp5 C A 2: 136,060,866 H168Q probably benign Het
Lilra5 A T 7: 4,242,077 Q240L possibly damaging Het
Lrp1 A T 10: 127,549,944 C3521S probably benign Het
Mroh1 T A 15: 76,408,530 probably null Het
Nlrp4g A T 9: 124,349,515 noncoding transcript Het
Nr2f6 A T 8: 71,378,535 I70N probably benign Het
Nr4a2 T A 2: 57,110,151 D311V probably damaging Het
Olfr1490 T A 19: 13,655,386 M319K probably benign Het
Olfr248 T C 1: 174,391,876 L269P probably damaging Het
Olfr659 T A 7: 104,671,504 F267L probably damaging Het
Pcdhb6 C A 18: 37,335,373 A449D possibly damaging Het
Pcgf6 A G 19: 47,048,106 probably null Het
Prc1 C A 7: 80,313,163 H131Q probably benign Het
Ptprq C A 10: 107,524,253 R2187L probably damaging Het
Rasl2-9 C A 7: 5,125,703 R76L possibly damaging Het
Rdh16f1 A T 10: 127,790,816 Y246F probably benign Het
Rit1 T C 3: 88,717,675 probably benign Het
Sash1 A G 10: 8,729,908 V906A probably benign Het
Scnn1b T C 7: 121,902,286 V108A probably benign Het
Sema4f A T 6: 82,918,284 I356N probably damaging Het
Shc4 A T 2: 125,649,277 L447Q probably damaging Het
Slc24a1 T C 9: 64,949,476 M50V unknown Het
Slc28a3 T A 13: 58,574,263 D269V possibly damaging Het
Slc35e1 A G 8: 72,492,322 S89P possibly damaging Het
Smpd5 T A 15: 76,294,808 H125Q probably benign Het
Snapc2 A G 8: 4,254,578 T31A probably damaging Het
Sox5 G C 6: 143,833,488 H606D possibly damaging Het
Spag6 A G 2: 18,737,296 T367A possibly damaging Het
Spag8 T C 4: 43,651,636 T413A probably damaging Het
Sptlc3 G A 2: 139,547,167 G156R probably damaging Het
Stx19 A G 16: 62,822,420 T200A probably benign Het
Tas2r116 A G 6: 132,855,705 T90A probably benign Het
Tbl3 A G 17: 24,705,330 probably benign Het
Tekt5 G T 16: 10,395,194 P76T probably damaging Het
Tjp2 C T 19: 24,096,666 E1086K possibly damaging Het
Topbp1 T C 9: 103,323,571 L601P probably damaging Het
Trav16 T A 14: 53,743,477 M41K possibly damaging Het
Trav6-5 C A 14: 53,491,503 N72K probably benign Het
Trpm3 C G 19: 22,715,295 T250S possibly damaging Het
Vps35 A T 8: 85,261,262 D753E probably benign Het
Vstm2a A T 11: 16,263,061 N149Y probably damaging Het
Vwa2 G T 19: 56,906,886 M497I probably benign Het
Zfat C A 15: 68,180,374 V517L probably benign Het
Zfp169 C A 13: 48,490,232 R473L possibly damaging Het
Zfp672 T C 11: 58,329,498 probably benign Het
Zranb1 T C 7: 132,972,714 V420A probably damaging Het
Other mutations in Hfm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Hfm1 APN 5 106902130 missense possibly damaging 0.70
IGL01295:Hfm1 APN 5 106917606 missense possibly damaging 0.46
IGL01725:Hfm1 APN 5 106917379 missense probably benign 0.00
IGL01758:Hfm1 APN 5 106904793 missense probably damaging 0.99
IGL01911:Hfm1 APN 5 106911544 missense possibly damaging 0.92
IGL02337:Hfm1 APN 5 106904267 missense possibly damaging 0.81
IGL02472:Hfm1 APN 5 106873928 splice site probably benign
IGL02496:Hfm1 APN 5 106901761 missense probably benign 0.00
IGL02545:Hfm1 APN 5 106895287 missense probably damaging 1.00
IGL02584:Hfm1 APN 5 106878662 splice site probably null
IGL02728:Hfm1 APN 5 106878823 missense probably benign 0.13
IGL02881:Hfm1 APN 5 106874252 missense probably damaging 1.00
IGL03108:Hfm1 APN 5 106895934 unclassified probably benign
IGL03351:Hfm1 APN 5 106911575 nonsense probably null
IGL03353:Hfm1 APN 5 106856929 missense probably damaging 0.99
R0024:Hfm1 UTSW 5 106856924 missense probably benign 0.41
R0024:Hfm1 UTSW 5 106856924 missense probably benign 0.41
R0094:Hfm1 UTSW 5 106917478 missense probably benign
R0633:Hfm1 UTSW 5 106917601 missense possibly damaging 0.56
R0644:Hfm1 UTSW 5 106898256 critical splice donor site probably null
R1078:Hfm1 UTSW 5 106878830 missense probably damaging 1.00
R1120:Hfm1 UTSW 5 106904218 splice site probably benign
R1166:Hfm1 UTSW 5 106911411 missense probably benign 0.00
R1242:Hfm1 UTSW 5 106874901 missense probably damaging 0.99
R1414:Hfm1 UTSW 5 106872353 missense probably benign 0.01
R1450:Hfm1 UTSW 5 106918458 missense probably damaging 0.99
R1529:Hfm1 UTSW 5 106853123 missense probably benign 0.00
R1622:Hfm1 UTSW 5 106893523 missense possibly damaging 0.58
R1710:Hfm1 UTSW 5 106880514 missense probably damaging 1.00
R1710:Hfm1 UTSW 5 106896003 missense probably damaging 0.96
R1757:Hfm1 UTSW 5 106880360 splice site probably null
R1856:Hfm1 UTSW 5 106847676 missense probably benign 0.00
R1984:Hfm1 UTSW 5 106898576 missense probably damaging 0.98
R1985:Hfm1 UTSW 5 106898576 missense probably damaging 0.98
R2040:Hfm1 UTSW 5 106901818 missense probably damaging 1.00
R2122:Hfm1 UTSW 5 106896255 missense probably damaging 1.00
R2426:Hfm1 UTSW 5 106847653 splice site probably null
R2474:Hfm1 UTSW 5 106872416 missense possibly damaging 0.81
R2926:Hfm1 UTSW 5 106874282 nonsense probably null
R2944:Hfm1 UTSW 5 106872330 missense probably damaging 1.00
R3705:Hfm1 UTSW 5 106892839 unclassified probably benign
R4256:Hfm1 UTSW 5 106904797 missense possibly damaging 0.83
R4455:Hfm1 UTSW 5 106886508 splice site probably null
R4538:Hfm1 UTSW 5 106874890 missense possibly damaging 0.47
R4540:Hfm1 UTSW 5 106874221 nonsense probably null
R4591:Hfm1 UTSW 5 106847667 missense probably benign 0.08
R4747:Hfm1 UTSW 5 106917523 missense probably benign
R4765:Hfm1 UTSW 5 106842539 missense probably benign 0.21
R4821:Hfm1 UTSW 5 106854740 critical splice donor site probably null
R4842:Hfm1 UTSW 5 106892751 missense probably damaging 1.00
R4944:Hfm1 UTSW 5 106874213 missense possibly damaging 0.46
R5093:Hfm1 UTSW 5 106901731 missense probably damaging 1.00
R5399:Hfm1 UTSW 5 106917562 missense possibly damaging 0.91
R5414:Hfm1 UTSW 5 106902076 missense probably damaging 1.00
R5436:Hfm1 UTSW 5 106892772 missense possibly damaging 0.61
R5459:Hfm1 UTSW 5 106904763 missense probably damaging 1.00
R5485:Hfm1 UTSW 5 106847662 critical splice donor site probably null
R5585:Hfm1 UTSW 5 106911439 missense probably benign 0.05
R5631:Hfm1 UTSW 5 106904763 missense probably damaging 1.00
R5705:Hfm1 UTSW 5 106911453 missense probably benign 0.21
R5804:Hfm1 UTSW 5 106878589 splice site probably null
R5959:Hfm1 UTSW 5 106874917 missense probably damaging 1.00
R6046:Hfm1 UTSW 5 106898643 splice site probably null
R6191:Hfm1 UTSW 5 106886553 missense possibly damaging 0.95
R6345:Hfm1 UTSW 5 106841638 missense probably benign
R6580:Hfm1 UTSW 5 106847709 missense probably benign 0.00
R6651:Hfm1 UTSW 5 106847687 missense probably benign 0.00
R6761:Hfm1 UTSW 5 106895279 missense probably damaging 1.00
R6835:Hfm1 UTSW 5 106878815 nonsense probably null
R6891:Hfm1 UTSW 5 106917374 missense possibly damaging 0.49
R6924:Hfm1 UTSW 5 106850410 splice site probably null
R6980:Hfm1 UTSW 5 106880477 missense probably benign 0.31
R7054:Hfm1 UTSW 5 106896043 missense probably benign 0.01
R7058:Hfm1 UTSW 5 106911440 missense probably benign 0.04
R7189:Hfm1 UTSW 5 106901703 critical splice donor site probably null
R7250:Hfm1 UTSW 5 106904331 missense probably benign 0.00
R7376:Hfm1 UTSW 5 106895218 missense possibly damaging 0.95
R7577:Hfm1 UTSW 5 106896043 missense probably benign 0.01
R7636:Hfm1 UTSW 5 106917466 missense probably benign 0.02
R7639:Hfm1 UTSW 5 106889925 missense probably benign 0.03
R7639:Hfm1 UTSW 5 106898475 missense possibly damaging 0.46
R7763:Hfm1 UTSW 5 106881861 missense probably damaging 1.00
R7828:Hfm1 UTSW 5 106881791 critical splice donor site probably null
R7905:Hfm1 UTSW 5 106898553 missense probably damaging 1.00
R8160:Hfm1 UTSW 5 106896033 missense probably null 0.00
R8477:Hfm1 UTSW 5 106881818 missense probably benign 0.01
R8739:Hfm1 UTSW 5 106898505 missense probably damaging 0.96
Z1177:Hfm1 UTSW 5 106871820 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAACTTCTCTGAGACCAAATTGAC -3'
(R):5'- AGGTAGTAAACACGTTCACTTTCAG -3'

Sequencing Primer
(F):5'- CTGAGACCAAATTGACTAAATATCCC -3'
(R):5'- CGTTCACTTTCAGAGATAAACACAG -3'
Posted On2015-11-11