Incidental Mutation 'R4745:Topbp1'
ID356662
Institutional Source Beutler Lab
Gene Symbol Topbp1
Ensembl Gene ENSMUSG00000032555
Gene Nametopoisomerase (DNA) II binding protein 1
SynonymsD430026L04Rik, 2810429C13Rik, 1110031N14Rik
MMRRC Submission 042028-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4745 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location103305215-103350428 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103323571 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 601 (L601P)
Ref Sequence ENSEMBL: ENSMUSP00000035164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035164]
Predicted Effect probably damaging
Transcript: ENSMUST00000035164
AA Change: L601P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035164
Gene: ENSMUSG00000032555
AA Change: L601P

DomainStartEndE-ValueType
BRCT 6 91 3.04e1 SMART
BRCT 103 179 1.51e-13 SMART
BRCT 197 274 4.69e-19 SMART
BRCT 355 433 3.58e-15 SMART
BRCT 553 626 5.57e-3 SMART
BRCT 646 731 1.53e-9 SMART
BRCT 904 983 3.48e-13 SMART
low complexity region 1097 1106 N/A INTRINSIC
low complexity region 1110 1121 N/A INTRINSIC
low complexity region 1213 1218 N/A INTRINSIC
BRCT 1258 1337 2.31e-9 SMART
Blast:BRCT 1387 1472 4e-52 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186897
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188840
Meta Mutation Damage Score 0.6496 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (89/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a binding protein which interacts with the C-terminal region of topoisomerase II beta. This interaction suggests a supportive role for this protein in the catalytic reactions of topoisomerase II beta through transient breakages of DNA strands. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele die around implantation due to embryonic growth arrest, increased apoptosis, and decreased cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,307,453 Y619C probably damaging Het
Adck1 A G 12: 88,402,179 probably null Het
Agap3 A C 5: 24,451,125 probably null Het
Ankib1 A T 5: 3,732,566 H354Q probably damaging Het
Ankrd29 T G 18: 12,254,622 N301T probably benign Het
Arhgef4 A G 1: 34,807,275 T379A probably damaging Het
Arid1a A G 4: 133,753,106 V169A probably benign Het
Armc4 G A 18: 7,286,763 T156M probably benign Het
Bag2 T C 1: 33,748,336 probably null Het
Bmt2 A C 6: 13,628,687 Y332* probably null Het
Bpifb1 A T 2: 154,211,581 K248* probably null Het
Caap1 C A 4: 94,556,514 probably null Het
Calcr T A 6: 3,692,576 Y389F probably damaging Het
Capn1 C T 19: 5,993,916 V562I probably benign Het
Ccr1 T A 9: 123,963,948 T182S probably benign Het
Ceacam15 T C 7: 16,673,334 D86G probably benign Het
Cldnd1 C T 16: 58,729,643 T63I probably benign Het
Col12a1 A T 9: 79,652,086 probably null Het
Cystm1 A G 18: 36,393,295 probably benign Het
Ddx55 T A 5: 124,566,965 Y428* probably null Het
Ensa G A 3: 95,631,434 G118D probably benign Het
Fam208b G A 13: 3,590,069 T356I probably benign Het
Folh1 A T 7: 86,723,274 probably null Het
Foxj2 C A 6: 122,837,989 P328Q probably damaging Het
Fscn3 A G 6: 28,435,628 I417V probably damaging Het
Galnt7 T C 8: 57,542,727 probably benign Het
Gm11563 T A 11: 99,658,420 *169C probably null Het
Hfm1 A T 5: 106,901,843 D417E possibly damaging Het
Ighv15-2 A G 12: 114,564,610 S107P probably damaging Het
Itsn2 A G 12: 4,661,944 D904G probably damaging Het
Kif1b A T 4: 149,237,882 L860* probably null Het
Krt79 T C 15: 101,930,684 E450G probably damaging Het
Lama1 T C 17: 67,738,780 S227P probably damaging Het
Lamp5 C A 2: 136,060,866 H168Q probably benign Het
Lilra5 A T 7: 4,242,077 Q240L possibly damaging Het
Lrp1 A T 10: 127,549,944 C3521S probably benign Het
Mroh1 T A 15: 76,408,530 probably null Het
Nlrp4g A T 9: 124,349,515 noncoding transcript Het
Nr2f6 A T 8: 71,378,535 I70N probably benign Het
Nr4a2 T A 2: 57,110,151 D311V probably damaging Het
Olfr1490 T A 19: 13,655,386 M319K probably benign Het
Olfr248 T C 1: 174,391,876 L269P probably damaging Het
Olfr659 T A 7: 104,671,504 F267L probably damaging Het
Pcdhb6 C A 18: 37,335,373 A449D possibly damaging Het
Pcgf6 A G 19: 47,048,106 probably null Het
Prc1 C A 7: 80,313,163 H131Q probably benign Het
Ptprq C A 10: 107,524,253 R2187L probably damaging Het
Rasl2-9 C A 7: 5,125,703 R76L possibly damaging Het
Rdh16f1 A T 10: 127,790,816 Y246F probably benign Het
Rit1 T C 3: 88,717,675 probably benign Het
Sash1 A G 10: 8,729,908 V906A probably benign Het
Scnn1b T C 7: 121,902,286 V108A probably benign Het
Sema4f A T 6: 82,918,284 I356N probably damaging Het
Shc4 A T 2: 125,649,277 L447Q probably damaging Het
Slc24a1 T C 9: 64,949,476 M50V unknown Het
Slc28a3 T A 13: 58,574,263 D269V possibly damaging Het
Slc35e1 A G 8: 72,492,322 S89P possibly damaging Het
Smpd5 T A 15: 76,294,808 H125Q probably benign Het
Snapc2 A G 8: 4,254,578 T31A probably damaging Het
Sox5 G C 6: 143,833,488 H606D possibly damaging Het
Spag6 A G 2: 18,737,296 T367A possibly damaging Het
Spag8 T C 4: 43,651,636 T413A probably damaging Het
Sptlc3 G A 2: 139,547,167 G156R probably damaging Het
Stx19 A G 16: 62,822,420 T200A probably benign Het
Tas2r116 A G 6: 132,855,705 T90A probably benign Het
Tbl3 A G 17: 24,705,330 probably benign Het
Tekt5 G T 16: 10,395,194 P76T probably damaging Het
Tjp2 C T 19: 24,096,666 E1086K possibly damaging Het
Trav16 T A 14: 53,743,477 M41K possibly damaging Het
Trav6-5 C A 14: 53,491,503 N72K probably benign Het
Trpm3 C G 19: 22,715,295 T250S possibly damaging Het
Vps35 A T 8: 85,261,262 D753E probably benign Het
Vstm2a A T 11: 16,263,061 N149Y probably damaging Het
Vwa2 G T 19: 56,906,886 M497I probably benign Het
Zfat C A 15: 68,180,374 V517L probably benign Het
Zfp169 C A 13: 48,490,232 R473L possibly damaging Het
Zfp672 T C 11: 58,329,498 probably benign Het
Zranb1 T C 7: 132,972,714 V420A probably damaging Het
Other mutations in Topbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Topbp1 APN 9 103344943 missense probably benign
IGL01524:Topbp1 APN 9 103311645 missense possibly damaging 0.92
IGL02335:Topbp1 APN 9 103328523 missense probably damaging 1.00
IGL02441:Topbp1 APN 9 103320239 missense possibly damaging 0.49
IGL02943:Topbp1 APN 9 103328440 missense probably benign 0.00
IGL02953:Topbp1 APN 9 103328435 missense probably benign 0.26
IGL03040:Topbp1 APN 9 103328667 missense possibly damaging 0.51
PIT4377001:Topbp1 UTSW 9 103309889 missense possibly damaging 0.90
R0044:Topbp1 UTSW 9 103325773 missense possibly damaging 0.94
R0344:Topbp1 UTSW 9 103328687 missense probably damaging 0.99
R0344:Topbp1 UTSW 9 103308733 splice site probably benign
R0591:Topbp1 UTSW 9 103349838 missense probably benign 0.01
R0666:Topbp1 UTSW 9 103308812 missense probably benign
R0785:Topbp1 UTSW 9 103315090 missense probably damaging 1.00
R0906:Topbp1 UTSW 9 103328593 missense probably benign 0.00
R1352:Topbp1 UTSW 9 103347008 missense probably benign
R1745:Topbp1 UTSW 9 103308845 missense probably benign 0.36
R2104:Topbp1 UTSW 9 103317982 splice site probably benign
R2166:Topbp1 UTSW 9 103312929 splice site probably null
R2230:Topbp1 UTSW 9 103345848 missense probably damaging 1.00
R2967:Topbp1 UTSW 9 103342140 missense probably benign 0.01
R3845:Topbp1 UTSW 9 103309923 missense possibly damaging 0.87
R4089:Topbp1 UTSW 9 103324501 critical splice donor site probably null
R4110:Topbp1 UTSW 9 103309959 missense probably damaging 0.98
R4454:Topbp1 UTSW 9 103344871 missense probably damaging 1.00
R4521:Topbp1 UTSW 9 103334202 intron probably benign
R4923:Topbp1 UTSW 9 103312836 missense probably benign 0.00
R4934:Topbp1 UTSW 9 103328369 unclassified probably benign
R4963:Topbp1 UTSW 9 103320605 missense probably benign 0.04
R5199:Topbp1 UTSW 9 103346672 unclassified probably benign
R5461:Topbp1 UTSW 9 103315196 missense probably benign 0.00
R5517:Topbp1 UTSW 9 103336114 missense probably benign 0.03
R5563:Topbp1 UTSW 9 103311513 missense possibly damaging 0.46
R5564:Topbp1 UTSW 9 103334078 missense probably damaging 1.00
R5683:Topbp1 UTSW 9 103312804 missense possibly damaging 0.93
R5774:Topbp1 UTSW 9 103328499 missense probably benign 0.06
R5785:Topbp1 UTSW 9 103323528 missense probably benign 0.00
R6029:Topbp1 UTSW 9 103344953 missense probably benign 0.00
R6077:Topbp1 UTSW 9 103332990 missense probably damaging 1.00
R6122:Topbp1 UTSW 9 103346961 missense probably benign 0.06
R6133:Topbp1 UTSW 9 103311764 splice site probably null
R6213:Topbp1 UTSW 9 103332751 missense probably benign 0.12
R6773:Topbp1 UTSW 9 103343692 missense possibly damaging 0.90
R6922:Topbp1 UTSW 9 103335846 missense probably damaging 1.00
R6938:Topbp1 UTSW 9 103328554 missense probably damaging 1.00
R7305:Topbp1 UTSW 9 103328637 missense probably damaging 1.00
R7419:Topbp1 UTSW 9 103323344 missense probably benign
R7517:Topbp1 UTSW 9 103332733 missense possibly damaging 0.82
R7605:Topbp1 UTSW 9 103332706 missense probably benign 0.41
R7701:Topbp1 UTSW 9 103332985 missense probably damaging 0.96
R7741:Topbp1 UTSW 9 103320557 missense probably damaging 0.97
R8115:Topbp1 UTSW 9 103320541 missense probably benign
R8177:Topbp1 UTSW 9 103320541 missense probably benign 0.01
R8269:Topbp1 UTSW 9 103328593 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- CACATTTCTGTGCAAGAGGAAAAC -3'
(R):5'- TGTTTTAAAATTGCCGTTGCCC -3'

Sequencing Primer
(F):5'- AACAAGTCGTCTGTCAGTCATTGC -3'
(R):5'- TTTAAAATTGCCGTTGCCCAAACC -3'
Posted On2015-11-11