Incidental Mutation 'R4745:Itsn2'
ID356672
Institutional Source Beutler Lab
Gene Symbol Itsn2
Ensembl Gene ENSMUSG00000020640
Gene Nameintersectin 2
SynonymsSh3d1B, Eh domain, SH3 domain regulator of endocytosis 2, Ese2, Sh3p18
MMRRC Submission 042028-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4745 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location4592638-4713962 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4661944 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 904 (D904G)
Ref Sequence ENSEMBL: ENSMUSP00000151896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062580] [ENSMUST00000219007] [ENSMUST00000220311]
Predicted Effect probably damaging
Transcript: ENSMUST00000062580
AA Change: D877G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052758
Gene: ENSMUSG00000020640
AA Change: D877G

DomainStartEndE-ValueType
EH 15 109 8.44e-41 SMART
EFh 58 86 7.18e-3 SMART
low complexity region 156 169 N/A INTRINSIC
low complexity region 215 231 N/A INTRINSIC
EH 238 333 4.06e-43 SMART
EFh 282 310 6.16e-2 SMART
coiled coil region 366 462 N/A INTRINSIC
coiled coil region 516 556 N/A INTRINSIC
coiled coil region 580 715 N/A INTRINSIC
SH3 721 778 2.65e-21 SMART
low complexity region 791 811 N/A INTRINSIC
SH3 855 909 8.83e-18 SMART
SH3 945 999 9.1e-20 SMART
SH3 1017 1077 1.55e-13 SMART
SH3 1091 1146 7.22e-23 SMART
RhoGEF 1174 1355 1.93e-56 SMART
PH 1396 1507 1.16e-9 SMART
C2 1531 1628 3.96e-19 SMART
Predicted Effect unknown
Transcript: ENSMUST00000217672
AA Change: D435G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218072
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218985
Predicted Effect probably damaging
Transcript: ENSMUST00000219007
AA Change: D877G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219832
Predicted Effect probably damaging
Transcript: ENSMUST00000220311
AA Change: D904G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.7495 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (89/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein which contains SH3 domains. This protein is a member of a family of proteins involved in clathrin-mediated endocytosis. Intersectin 2 is thought to regulate the formation of clathrin-coated vesicles and also may function in the induction of T cell antigen receptor (TCR) endocytosis. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal brain morphology and function and behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,307,453 Y619C probably damaging Het
Adck1 A G 12: 88,402,179 probably null Het
Agap3 A C 5: 24,451,125 probably null Het
Ankib1 A T 5: 3,732,566 H354Q probably damaging Het
Ankrd29 T G 18: 12,254,622 N301T probably benign Het
Arhgef4 A G 1: 34,807,275 T379A probably damaging Het
Arid1a A G 4: 133,753,106 V169A probably benign Het
Armc4 G A 18: 7,286,763 T156M probably benign Het
Bag2 T C 1: 33,748,336 probably null Het
Bmt2 A C 6: 13,628,687 Y332* probably null Het
Bpifb1 A T 2: 154,211,581 K248* probably null Het
Caap1 C A 4: 94,556,514 probably null Het
Calcr T A 6: 3,692,576 Y389F probably damaging Het
Capn1 C T 19: 5,993,916 V562I probably benign Het
Ccr1 T A 9: 123,963,948 T182S probably benign Het
Ceacam15 T C 7: 16,673,334 D86G probably benign Het
Cldnd1 C T 16: 58,729,643 T63I probably benign Het
Col12a1 A T 9: 79,652,086 probably null Het
Cystm1 A G 18: 36,393,295 probably benign Het
Ddx55 T A 5: 124,566,965 Y428* probably null Het
Ensa G A 3: 95,631,434 G118D probably benign Het
Fam208b G A 13: 3,590,069 T356I probably benign Het
Folh1 A T 7: 86,723,274 probably null Het
Foxj2 C A 6: 122,837,989 P328Q probably damaging Het
Fscn3 A G 6: 28,435,628 I417V probably damaging Het
Galnt7 T C 8: 57,542,727 probably benign Het
Gm11563 T A 11: 99,658,420 *169C probably null Het
Hfm1 A T 5: 106,901,843 D417E possibly damaging Het
Ighv15-2 A G 12: 114,564,610 S107P probably damaging Het
Kif1b A T 4: 149,237,882 L860* probably null Het
Krt79 T C 15: 101,930,684 E450G probably damaging Het
Lama1 T C 17: 67,738,780 S227P probably damaging Het
Lamp5 C A 2: 136,060,866 H168Q probably benign Het
Lilra5 A T 7: 4,242,077 Q240L possibly damaging Het
Lrp1 A T 10: 127,549,944 C3521S probably benign Het
Mroh1 T A 15: 76,408,530 probably null Het
Nlrp4g A T 9: 124,349,515 noncoding transcript Het
Nr2f6 A T 8: 71,378,535 I70N probably benign Het
Nr4a2 T A 2: 57,110,151 D311V probably damaging Het
Olfr1490 T A 19: 13,655,386 M319K probably benign Het
Olfr248 T C 1: 174,391,876 L269P probably damaging Het
Olfr659 T A 7: 104,671,504 F267L probably damaging Het
Pcdhb6 C A 18: 37,335,373 A449D possibly damaging Het
Pcgf6 A G 19: 47,048,106 probably null Het
Prc1 C A 7: 80,313,163 H131Q probably benign Het
Ptprq C A 10: 107,524,253 R2187L probably damaging Het
Rasl2-9 C A 7: 5,125,703 R76L possibly damaging Het
Rdh16f1 A T 10: 127,790,816 Y246F probably benign Het
Rit1 T C 3: 88,717,675 probably benign Het
Sash1 A G 10: 8,729,908 V906A probably benign Het
Scnn1b T C 7: 121,902,286 V108A probably benign Het
Sema4f A T 6: 82,918,284 I356N probably damaging Het
Shc4 A T 2: 125,649,277 L447Q probably damaging Het
Slc24a1 T C 9: 64,949,476 M50V unknown Het
Slc28a3 T A 13: 58,574,263 D269V possibly damaging Het
Slc35e1 A G 8: 72,492,322 S89P possibly damaging Het
Smpd5 T A 15: 76,294,808 H125Q probably benign Het
Snapc2 A G 8: 4,254,578 T31A probably damaging Het
Sox5 G C 6: 143,833,488 H606D possibly damaging Het
Spag6 A G 2: 18,737,296 T367A possibly damaging Het
Spag8 T C 4: 43,651,636 T413A probably damaging Het
Sptlc3 G A 2: 139,547,167 G156R probably damaging Het
Stx19 A G 16: 62,822,420 T200A probably benign Het
Tas2r116 A G 6: 132,855,705 T90A probably benign Het
Tbl3 A G 17: 24,705,330 probably benign Het
Tekt5 G T 16: 10,395,194 P76T probably damaging Het
Tjp2 C T 19: 24,096,666 E1086K possibly damaging Het
Topbp1 T C 9: 103,323,571 L601P probably damaging Het
Trav16 T A 14: 53,743,477 M41K possibly damaging Het
Trav6-5 C A 14: 53,491,503 N72K probably benign Het
Trpm3 C G 19: 22,715,295 T250S possibly damaging Het
Vps35 A T 8: 85,261,262 D753E probably benign Het
Vstm2a A T 11: 16,263,061 N149Y probably damaging Het
Vwa2 G T 19: 56,906,886 M497I probably benign Het
Zfat C A 15: 68,180,374 V517L probably benign Het
Zfp169 C A 13: 48,490,232 R473L possibly damaging Het
Zfp672 T C 11: 58,329,498 probably benign Het
Zranb1 T C 7: 132,972,714 V420A probably damaging Het
Other mutations in Itsn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Itsn2 APN 12 4658027 missense possibly damaging 0.95
IGL00647:Itsn2 APN 12 4613311 splice site probably benign
IGL00933:Itsn2 APN 12 4707540 missense probably damaging 1.00
IGL01686:Itsn2 APN 12 4636693 splice site probably benign
IGL01873:Itsn2 APN 12 4632366 splice site probably benign
IGL02200:Itsn2 APN 12 4636632 missense probably damaging 0.98
IGL02280:Itsn2 APN 12 4708961 missense possibly damaging 0.89
IGL02388:Itsn2 APN 12 4629557 missense possibly damaging 0.91
IGL02938:Itsn2 APN 12 4697216 missense probably damaging 0.98
inversus UTSW 12 4639670 nonsense probably null
Liberator UTSW 12 4666176 nonsense probably null
rolled UTSW 12 4634792 nonsense probably null
Stratofortress UTSW 12 4624927 missense probably damaging 1.00
R0101:Itsn2 UTSW 12 4633058 unclassified probably benign
R0268:Itsn2 UTSW 12 4700333 missense probably benign 0.12
R0584:Itsn2 UTSW 12 4697180 missense probably benign
R0604:Itsn2 UTSW 12 4658189 missense probably benign 0.01
R0639:Itsn2 UTSW 12 4712556 missense probably damaging 0.99
R0738:Itsn2 UTSW 12 4635681 missense probably benign 0.17
R1132:Itsn2 UTSW 12 4658464 missense probably damaging 1.00
R1163:Itsn2 UTSW 12 4712009 missense probably benign 0.30
R1169:Itsn2 UTSW 12 4639694 missense probably damaging 1.00
R1258:Itsn2 UTSW 12 4673464 missense probably damaging 1.00
R1297:Itsn2 UTSW 12 4700378 missense probably damaging 1.00
R1423:Itsn2 UTSW 12 4673572 missense probably damaging 0.97
R1572:Itsn2 UTSW 12 4650044 missense probably benign 0.03
R1601:Itsn2 UTSW 12 4658452 missense probably benign 0.01
R1628:Itsn2 UTSW 12 4629652 missense probably benign
R1650:Itsn2 UTSW 12 4637767 missense probably damaging 0.97
R1752:Itsn2 UTSW 12 4711950 splice site probably null
R1758:Itsn2 UTSW 12 4658160 missense possibly damaging 0.83
R1942:Itsn2 UTSW 12 4639670 nonsense probably null
R1976:Itsn2 UTSW 12 4672733 splice site probably benign
R2000:Itsn2 UTSW 12 4666176 nonsense probably null
R2060:Itsn2 UTSW 12 4627879 missense probably damaging 1.00
R2119:Itsn2 UTSW 12 4707025 missense probably benign 0.32
R2168:Itsn2 UTSW 12 4633044 unclassified probably benign
R2394:Itsn2 UTSW 12 4707005 missense possibly damaging 0.86
R2860:Itsn2 UTSW 12 4700315 splice site probably benign
R2861:Itsn2 UTSW 12 4700315 splice site probably benign
R2900:Itsn2 UTSW 12 4630713 unclassified probably benign
R2991:Itsn2 UTSW 12 4658474 missense probably benign 0.01
R3087:Itsn2 UTSW 12 4666303 missense probably damaging 1.00
R3881:Itsn2 UTSW 12 4634546 unclassified probably benign
R4022:Itsn2 UTSW 12 4624927 missense probably damaging 1.00
R4332:Itsn2 UTSW 12 4712611 missense possibly damaging 0.72
R4657:Itsn2 UTSW 12 4713197 makesense probably null
R4727:Itsn2 UTSW 12 4707660 missense probably damaging 0.99
R4770:Itsn2 UTSW 12 4627892 missense probably damaging 1.00
R4905:Itsn2 UTSW 12 4634583 unclassified probably benign
R5269:Itsn2 UTSW 12 4633553 unclassified probably benign
R5314:Itsn2 UTSW 12 4627960 missense probably benign 0.09
R5345:Itsn2 UTSW 12 4672783 missense probably damaging 1.00
R5399:Itsn2 UTSW 12 4653535 missense probably benign 0.22
R5566:Itsn2 UTSW 12 4626554 missense probably damaging 1.00
R5725:Itsn2 UTSW 12 4630767 unclassified probably benign
R5773:Itsn2 UTSW 12 4707089 missense probably damaging 1.00
R6116:Itsn2 UTSW 12 4629939 unclassified probably benign
R6254:Itsn2 UTSW 12 4624982 splice site probably null
R6325:Itsn2 UTSW 12 4706351 missense probably damaging 1.00
R6361:Itsn2 UTSW 12 4629655 missense probably benign 0.18
R6456:Itsn2 UTSW 12 4629923 unclassified probably benign
R6494:Itsn2 UTSW 12 4634792 nonsense probably null
R6854:Itsn2 UTSW 12 4652382 missense probably benign 0.37
R6941:Itsn2 UTSW 12 4629641 missense probably benign 0.05
R6961:Itsn2 UTSW 12 4673420 nonsense probably null
R7326:Itsn2 UTSW 12 4632985 missense unknown
R7387:Itsn2 UTSW 12 4639781 missense probably damaging 1.00
R7465:Itsn2 UTSW 12 4706983 nonsense probably null
R7471:Itsn2 UTSW 12 4708198 missense probably benign 0.43
R7814:Itsn2 UTSW 12 4658561 missense probably benign 0.14
Z1088:Itsn2 UTSW 12 4712472 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTGCTGTGATGAAGTGGC -3'
(R):5'- GCTCATGTGGTAAGGACACC -3'

Sequencing Primer
(F):5'- AAGGCGACTCACATGGCTG -3'
(R):5'- TGGTAAGGACACCAGCGTC -3'
Posted On2015-11-11