Incidental Mutation 'R4745:Trav6-5'
ID356678
Institutional Source Beutler Lab
Gene Symbol Trav6-5
Ensembl Gene ENSMUSG00000096149
Gene NameT cell receptor alpha variable 6-5
Synonyms
MMRRC Submission 042028-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.220) question?
Stock #R4745 (G1)
Quality Score102
Status Validated
Chromosome14
Chromosomal Location53491115-53491620 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 53491503 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 72 (N72K)
Ref Sequence ENSEMBL: ENSMUSP00000139176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103581] [ENSMUST00000181210] [ENSMUST00000183488]
Predicted Effect probably benign
Transcript: ENSMUST00000103581
SMART Domains Protein: ENSMUSP00000100358
Gene: ENSMUSG00000096900

DomainStartEndE-ValueType
IGv 36 111 1.61e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000181210
AA Change: N73K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000137814
Gene: ENSMUSG00000096149
AA Change: N73K

DomainStartEndE-ValueType
IG 27 112 4.04e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183488
AA Change: N72K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000139176
Gene: ENSMUSG00000096149
AA Change: N72K

DomainStartEndE-ValueType
IG 26 111 4.04e0 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (89/92)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,307,453 Y619C probably damaging Het
Adck1 A G 12: 88,402,179 probably null Het
Agap3 A C 5: 24,451,125 probably null Het
Ankib1 A T 5: 3,732,566 H354Q probably damaging Het
Ankrd29 T G 18: 12,254,622 N301T probably benign Het
Arhgef4 A G 1: 34,807,275 T379A probably damaging Het
Arid1a A G 4: 133,753,106 V169A probably benign Het
Armc4 G A 18: 7,286,763 T156M probably benign Het
Bag2 T C 1: 33,748,336 probably null Het
Bmt2 A C 6: 13,628,687 Y332* probably null Het
Bpifb1 A T 2: 154,211,581 K248* probably null Het
Caap1 C A 4: 94,556,514 probably null Het
Calcr T A 6: 3,692,576 Y389F probably damaging Het
Capn1 C T 19: 5,993,916 V562I probably benign Het
Ccr1 T A 9: 123,963,948 T182S probably benign Het
Ceacam15 T C 7: 16,673,334 D86G probably benign Het
Cldnd1 C T 16: 58,729,643 T63I probably benign Het
Col12a1 A T 9: 79,652,086 probably null Het
Cystm1 A G 18: 36,393,295 probably benign Het
Ddx55 T A 5: 124,566,965 Y428* probably null Het
Ensa G A 3: 95,631,434 G118D probably benign Het
Fam208b G A 13: 3,590,069 T356I probably benign Het
Folh1 A T 7: 86,723,274 probably null Het
Foxj2 C A 6: 122,837,989 P328Q probably damaging Het
Fscn3 A G 6: 28,435,628 I417V probably damaging Het
Galnt7 T C 8: 57,542,727 probably benign Het
Gm11563 T A 11: 99,658,420 *169C probably null Het
Hfm1 A T 5: 106,901,843 D417E possibly damaging Het
Ighv15-2 A G 12: 114,564,610 S107P probably damaging Het
Itsn2 A G 12: 4,661,944 D904G probably damaging Het
Kif1b A T 4: 149,237,882 L860* probably null Het
Krt79 T C 15: 101,930,684 E450G probably damaging Het
Lama1 T C 17: 67,738,780 S227P probably damaging Het
Lamp5 C A 2: 136,060,866 H168Q probably benign Het
Lilra5 A T 7: 4,242,077 Q240L possibly damaging Het
Lrp1 A T 10: 127,549,944 C3521S probably benign Het
Mroh1 T A 15: 76,408,530 probably null Het
Nlrp4g A T 9: 124,349,515 noncoding transcript Het
Nr2f6 A T 8: 71,378,535 I70N probably benign Het
Nr4a2 T A 2: 57,110,151 D311V probably damaging Het
Olfr1490 T A 19: 13,655,386 M319K probably benign Het
Olfr248 T C 1: 174,391,876 L269P probably damaging Het
Olfr659 T A 7: 104,671,504 F267L probably damaging Het
Pcdhb6 C A 18: 37,335,373 A449D possibly damaging Het
Pcgf6 A G 19: 47,048,106 probably null Het
Prc1 C A 7: 80,313,163 H131Q probably benign Het
Ptprq C A 10: 107,524,253 R2187L probably damaging Het
Rasl2-9 C A 7: 5,125,703 R76L possibly damaging Het
Rdh16f1 A T 10: 127,790,816 Y246F probably benign Het
Rit1 T C 3: 88,717,675 probably benign Het
Sash1 A G 10: 8,729,908 V906A probably benign Het
Scnn1b T C 7: 121,902,286 V108A probably benign Het
Sema4f A T 6: 82,918,284 I356N probably damaging Het
Shc4 A T 2: 125,649,277 L447Q probably damaging Het
Slc24a1 T C 9: 64,949,476 M50V unknown Het
Slc28a3 T A 13: 58,574,263 D269V possibly damaging Het
Slc35e1 A G 8: 72,492,322 S89P possibly damaging Het
Smpd5 T A 15: 76,294,808 H125Q probably benign Het
Snapc2 A G 8: 4,254,578 T31A probably damaging Het
Sox5 G C 6: 143,833,488 H606D possibly damaging Het
Spag6 A G 2: 18,737,296 T367A possibly damaging Het
Spag8 T C 4: 43,651,636 T413A probably damaging Het
Sptlc3 G A 2: 139,547,167 G156R probably damaging Het
Stx19 A G 16: 62,822,420 T200A probably benign Het
Tas2r116 A G 6: 132,855,705 T90A probably benign Het
Tbl3 A G 17: 24,705,330 probably benign Het
Tekt5 G T 16: 10,395,194 P76T probably damaging Het
Tjp2 C T 19: 24,096,666 E1086K possibly damaging Het
Topbp1 T C 9: 103,323,571 L601P probably damaging Het
Trav16 T A 14: 53,743,477 M41K possibly damaging Het
Trpm3 C G 19: 22,715,295 T250S possibly damaging Het
Vps35 A T 8: 85,261,262 D753E probably benign Het
Vstm2a A T 11: 16,263,061 N149Y probably damaging Het
Vwa2 G T 19: 56,906,886 M497I probably benign Het
Zfat C A 15: 68,180,374 V517L probably benign Het
Zfp169 C A 13: 48,490,232 R473L possibly damaging Het
Zfp672 T C 11: 58,329,498 probably benign Het
Zranb1 T C 7: 132,972,714 V420A probably damaging Het
Other mutations in Trav6-5
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3942:Trav6-5 UTSW 14 53491381 missense probably benign 0.01
R4704:Trav6-5 UTSW 14 53491426 nonsense probably null
R5168:Trav6-5 UTSW 14 53491516 missense probably benign 0.02
R5229:Trav6-5 UTSW 14 53491588 missense probably damaging 0.98
R6234:Trav6-5 UTSW 14 53491375 missense probably benign 0.01
R7729:Trav6-5 UTSW 14 53491507 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCAATGGAGACTCAGTGAC -3'
(R):5'- TGGTATCAACAAGAGCAGACCTG -3'

Sequencing Primer
(F):5'- TGGAGACTCAGTGACTCAGAC -3'
(R):5'- CTCGTGGTCCCTAAATGAGTGATC -3'
Posted On2015-11-11