Mutagenetix > Incidental Mutations

Incidental Mutation 'R4746:Ptprf'

356717

Institutional Source

Beutler Lab

Gene Symbol

Ptprf

Ensembl Gene

ENSMUSG00000033295

Gene Name

protein tyrosine phosphatase, receptor type, F

Synonyms

RPTP-LAR, LAR

MMRRC Submission

041968-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.613) question?

Stock #

R4746 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

118208213-118291405 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 118225039 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 414 (V414A)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049074]

Predicted Effect

probably benign
Transcript: ENSMUST00000049074
AA Change: V1033A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000039368
Gene: ENSMUSG00000033295
AA Change: V1033A

Domain	Start	End	E-Value	Type
IGc2	45	114	2.64e-12	SMART
IGc2	147	214	1.48e-15	SMART
IG	238	316	1.06e-11	SMART
FN3	319	398	6.9e-14	SMART
FN3	414	497	5.73e-11	SMART
FN3	512	591	4.06e-11	SMART
FN3	606	693	8.69e-11	SMART
FN3	709	797	8.83e-12	SMART
FN3	812	892	3.2e-9	SMART
FN3	907	988	2.53e-12	SMART
FN3	1003	1079	3.48e-1	SMART
coiled coil region	1146	1175	N/A	INTRINSIC
transmembrane domain	1253	1275	N/A	INTRINSIC
PTPc	1342	1600	1.12e-138	SMART
PTPc	1629	1891	3.4e-129	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000124758
AA Change: V455A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000119954
Gene: ENSMUSG00000033295
AA Change: V455A

Domain	Start	End	E-Value	Type
FN3	37	116	4.06e-11	SMART
FN3	132	220	8.83e-12	SMART
FN3	235	315	3.2e-9	SMART
FN3	330	411	2.53e-12	SMART
FN3	426	502	3.48e-1	SMART
coiled coil region	568	597	N/A	INTRINSIC
transmembrane domain	676	698	N/A	INTRINSIC
PTPc	776	1034	1.12e-138	SMART
PTPc	1063	1325	3.4e-129	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143348

Predicted Effect

possibly damaging
Transcript: ENSMUST00000150096
AA Change: V414A

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000117313
Gene: ENSMUSG00000033295
AA Change: V414A

Domain	Start	End	E-Value	Type
FN3	14	66	2.7e1	SMART
FN3	82	165	5.73e-11	SMART
FN3	180	259	4.06e-11	SMART
FN3	275	372	6.69e-12	SMART
FN3	385	461	2.83e-1	SMART
coiled coil region	527	556	N/A	INTRINSIC
transmembrane domain	635	657	N/A	INTRINSIC
PTPc	735	993	1.12e-138	SMART
PTPc	1022	1284	3.4e-129	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains three Ig-like domains, and nine non-Ig like domains similar to that of neural-cell adhesion molecule. This PTP was shown to function in the regulation of epithelial cell-cell contacts at adherents junctions, as well as in the control of beta-catenin signaling. An increased expression level of this protein was found in the insulin-responsive tissue of obese, insulin-resistant individuals, and may contribute to the pathogenesis of insulin resistance. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null females have premature involution of the mammary glands leading to an inability to feed pups. Other characteristics of null mice include defective nerve regeneration and hyperactivity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6820408C15Rik	G	A	2: 152,440,765	S180N	probably benign	Het
Atp5a1	G	T	18: 77,778,742	G165V	probably benign	Het
Cbfa2t2	A	C	2: 154,523,925	M352L	possibly damaging	Het
Ccser2	A	T	14: 36,909,125	D98E	probably damaging	Het
Cfap20	A	G	8: 95,422,056		probably null	Het
Chuk	A	T	19: 44,088,771	C379S	possibly damaging	Het
Cic	G	A	7: 25,288,480	G1531E	probably damaging	Het
Ckap4	A	G	10: 84,533,520	V116A	possibly damaging	Het
Cxcl13	A	G	5: 95,959,897	K71E	probably damaging	Het
Dmxl2	A	T	9: 54,451,796	I210N	probably benign	Het
Donson	A	C	16: 91,682,237	V397G	probably damaging	Het
Dpy19l1	C	A	9: 24,450,670	V332L	probably benign	Het
Dsp	T	C	13: 38,195,104	S1343P	possibly damaging	Het
Egflam	A	G	15: 7,224,639		probably null	Het
Eif2b4	A	G	5: 31,187,653	I550T	probably damaging	Het
Fbxo47	A	T	11: 97,879,428	V46D	probably benign	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Folr1	T	A	7: 101,863,977	D37V	probably damaging	Het
Gm17333	AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA	AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA	16: 77,852,878		noncoding transcript	Het
Gnb1	C	A	4: 155,543,074	A104E	probably damaging	Het
Gnptg	ATTGTTGATGATTT	AT	17: 25,235,597		probably benign	Het
Htra4	A	T	8: 25,033,697	V284E	probably damaging	Het
Igkv3-3	A	T	6: 70,687,324	D50V	probably benign	Het
Irs3	A	G	5: 137,643,947	S410P	probably benign	Het
Kif26b	C	T	1: 178,873,981	Q642*	probably null	Het
Klhl11	A	T	11: 100,464,350	M215K	probably benign	Het
Lamc3	A	G	2: 31,905,614	N337S	possibly damaging	Het
Lrrc55	G	A	2: 85,196,170	A170V	probably damaging	Het
March3	A	T	18: 56,776,072	W214R	probably damaging	Het
Megf11	A	C	9: 64,508,745	T79P	probably damaging	Het
Mia3	A	G	1: 183,345,220	V26A	possibly damaging	Het
Myrf	A	G	19: 10,218,591	F353S	probably damaging	Het
Obscn	A	G	11: 59,079,808		probably null	Het
Ocstamp	T	C	2: 165,396,288	K352R	probably benign	Het
Olfr721-ps1	A	T	14: 14,407,359	I46F	probably benign	Het
Olfr874	G	T	9: 37,746,157	V8L	probably benign	Het
Osbpl3	T	C	6: 50,328,674	N434S	probably damaging	Het
Pign	A	C	1: 105,585,024	L645V	probably benign	Het
Polr2a	A	G	11: 69,735,674	S1540P	probably benign	Het
Ppp2r3c	A	T	12: 55,302,635		probably null	Het
Pyroxd2	G	A	19: 42,752,400	R22*	probably null	Het
Rab11fip2	G	A	19: 59,937,110	A225V	probably damaging	Het
Ranbp2	C	T	10: 58,492,670	A2836V	probably damaging	Het
Rimklb	G	A	6: 122,472,632	R28*	probably null	Het
Scyl3	G	A	1: 163,949,251	R404Q	probably damaging	Het
Slc9a8	A	T	2: 167,441,170	K79*	probably null	Het
Sowaha	A	T	11: 53,479,336		probably null	Het
Tnk1	A	G	11: 69,855,166	V311A	probably damaging	Het
Tnrc6a	T	A	7: 123,189,997	S1680T	probably damaging	Het
Tpp1	T	C	7: 105,748,951	Y335C	probably damaging	Het
Ttc39b	A	G	4: 83,244,103	V308A	probably benign	Het
Ttll3	A	C	6: 113,407,392	Q557P	probably damaging	Het
Ulk3	G	A	9: 57,592,918	A266T	probably benign	Het
Wfdc6b	C	A	2: 164,617,433	C138*	probably null	Het
Znrd1as	A	T	17: 36,964,873	I116L	probably benign	Het

Other mutations in Ptprf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Ptprf	APN	4	118223220	splice site	probably benign
IGL01337:Ptprf	APN	4	118236291	missense	probably damaging	1.00
IGL01482:Ptprf	APN	4	118212454	missense	probably damaging	1.00
IGL01743:Ptprf	APN	4	118248898	critical splice donor site	probably null
IGL01987:Ptprf	APN	4	118277370	missense	probably benign
IGL02189:Ptprf	APN	4	118213642	splice site	probably benign
IGL03067:Ptprf	APN	4	118210713	missense	possibly damaging	0.67
PIT4677001:Ptprf	UTSW	4	118213612	missense	probably damaging	1.00
R0382:Ptprf	UTSW	4	118223394	splice site	probably benign
R0788:Ptprf	UTSW	4	118226466	missense	probably damaging	0.97
R1164:Ptprf	UTSW	4	118257492	missense	probably damaging	1.00
R1478:Ptprf	UTSW	4	118212105	nonsense	probably null
R1483:Ptprf	UTSW	4	118235964	missense	possibly damaging	0.81
R1611:Ptprf	UTSW	4	118236233	missense	probably benign	0.34
R1721:Ptprf	UTSW	4	118224899	missense	possibly damaging	0.56
R1817:Ptprf	UTSW	4	118223265	missense	probably benign	0.02
R1818:Ptprf	UTSW	4	118209871	missense	probably damaging	1.00
R1860:Ptprf	UTSW	4	118223932	missense	probably damaging	1.00
R2208:Ptprf	UTSW	4	118269172	splice site	probably benign
R2406:Ptprf	UTSW	4	118269304	missense	possibly damaging	0.62
R2912:Ptprf	UTSW	4	118248980	missense	probably damaging	0.98
R3111:Ptprf	UTSW	4	118211432	missense	probably damaging	1.00
R3498:Ptprf	UTSW	4	118224930	missense	probably damaging	0.99
R3499:Ptprf	UTSW	4	118224930	missense	probably damaging	0.99
R3615:Ptprf	UTSW	4	118237883	missense	probably benign	0.04
R3616:Ptprf	UTSW	4	118237883	missense	probably benign	0.04
R4038:Ptprf	UTSW	4	118257608	missense	probably damaging	1.00
R4243:Ptprf	UTSW	4	118226452	critical splice donor site	probably null
R4260:Ptprf	UTSW	4	118226083	missense	possibly damaging	0.64
R4693:Ptprf	UTSW	4	118211022	missense	probably benign	0.16
R4726:Ptprf	UTSW	4	118212217	missense	possibly damaging	0.86
R4802:Ptprf	UTSW	4	118210329	intron	probably benign
R4857:Ptprf	UTSW	4	118217197	splice site	probably benign
R5071:Ptprf	UTSW	4	118211999	missense	probably damaging	1.00
R5221:Ptprf	UTSW	4	118225108	missense	probably benign	0.00
R5327:Ptprf	UTSW	4	118236389	missense	probably damaging	1.00
R5336:Ptprf	UTSW	4	118235634	missense	probably damaging	1.00
R5356:Ptprf	UTSW	4	118226338	missense	probably benign	0.00
R5373:Ptprf	UTSW	4	118226041	missense	possibly damaging	0.93
R5555:Ptprf	UTSW	4	118224924	missense	probably damaging	1.00
R5693:Ptprf	UTSW	4	118236177	nonsense	probably null
R5860:Ptprf	UTSW	4	118211289	intron	probably benign
R5869:Ptprf	UTSW	4	118210382	missense	probably damaging	1.00
R5890:Ptprf	UTSW	4	118224735	missense	probably benign
R5932:Ptprf	UTSW	4	118211767	missense	probably benign	0.10
R6028:Ptprf	UTSW	4	118213629	missense	probably benign	0.01
R6030:Ptprf	UTSW	4	118211048	missense	probably benign	0.19
R6030:Ptprf	UTSW	4	118211048	missense	probably benign	0.19
R6088:Ptprf	UTSW	4	118210755	missense	possibly damaging	0.68
R6089:Ptprf	UTSW	4	118211084	missense	probably damaging	0.99
R6108:Ptprf	UTSW	4	118223256	missense	probably benign	0.01
R6320:Ptprf	UTSW	4	118212814	missense	probably benign
R6741:Ptprf	UTSW	4	118223368	missense	probably benign	0.00
R6744:Ptprf	UTSW	4	118236365	missense	probably benign	0.00
R6750:Ptprf	UTSW	4	118231731	missense	probably benign	0.03
R6906:Ptprf	UTSW	4	118269277	missense	possibly damaging	0.95
R7021:Ptprf	UTSW	4	118223904	missense	probably benign	0.00
R7153:Ptprf	UTSW	4	118231543	missense	probably damaging	1.00
R7326:Ptprf	UTSW	4	118231669	missense	probably damaging	0.99
R7337:Ptprf	UTSW	4	118211125	missense	probably damaging	0.99
R7374:Ptprf	UTSW	4	118257492	missense	probably damaging	1.00
R7375:Ptprf	UTSW	4	118212814	missense	probably benign
R7399:Ptprf	UTSW	4	118226523	missense	probably benign	0.28
R7417:Ptprf	UTSW	4	118212172	missense	probably damaging	1.00
R7448:Ptprf	UTSW	4	118235667	missense	probably benign	0.03
R7530:Ptprf	UTSW	4	118212748	missense	probably damaging	1.00
R7593:Ptprf	UTSW	4	118212396	missense	probably benign	0.00
R8172:Ptprf	UTSW	4	118211078	missense	probably benign	0.03
R8239:Ptprf	UTSW	4	118212112	missense	possibly damaging	0.88
R8257:Ptprf	UTSW	4	118226279	missense	probably damaging	0.96
R8331:Ptprf	UTSW	4	118226066	missense	probably benign	0.27
R8441:Ptprf	UTSW	4	118218058	splice site	probably benign
X0067:Ptprf	UTSW	4	118236026	missense	possibly damaging	0.85
Z1177:Ptprf	UTSW	4	118269615	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- CTACTGCCACGATTCATCAGG -3'
(R):5'- TACTCCTGTGCTACAGCCATTG -3'

Sequencing Primer
(F):5'- TTCATCAGGACGAAGGAGTACTC -3'
(R):5'- AGCCATTGTCACATCCTCGGG -3'

Posted On

2015-11-11