Incidental Mutation 'R0403:Sec24b'
ID35672
Institutional Source Beutler Lab
Gene Symbol Sec24b
Ensembl Gene ENSMUSG00000001052
Gene NameSec24 related gene family, member B (S. cerevisiae)
SynonymsSEC24
MMRRC Submission 038608-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.646) question?
Stock #R0403 (G1)
Quality Score108
Status Validated
Chromosome3
Chromosomal Location129982759-130061553 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129999534 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 685 (S685P)
Ref Sequence ENSEMBL: ENSMUSP00000001079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001079] [ENSMUST00000165873]
Predicted Effect probably damaging
Transcript: ENSMUST00000001079
AA Change: S685P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000001079
Gene: ENSMUSG00000001052
AA Change: S685P

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 127 143 N/A INTRINSIC
low complexity region 229 254 N/A INTRINSIC
low complexity region 316 333 N/A INTRINSIC
low complexity region 351 362 N/A INTRINSIC
low complexity region 363 373 N/A INTRINSIC
low complexity region 378 386 N/A INTRINSIC
low complexity region 419 444 N/A INTRINSIC
low complexity region 450 473 N/A INTRINSIC
low complexity region 486 505 N/A INTRINSIC
low complexity region 555 568 N/A INTRINSIC
Pfam:zf-Sec23_Sec24 585 622 4.1e-17 PFAM
Pfam:Sec23_trunk 658 897 2.4e-87 PFAM
Pfam:Sec23_BS 902 986 3.4e-23 PFAM
Pfam:Sec23_helical 999 1099 8.7e-31 PFAM
Pfam:Gelsolin 1122 1197 4.9e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165873
AA Change: S422P

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132861
Gene: ENSMUSG00000001052
AA Change: S422P

DomainStartEndE-ValueType
low complexity region 1 26 N/A INTRINSIC
low complexity region 88 105 N/A INTRINSIC
low complexity region 115 123 N/A INTRINSIC
low complexity region 156 181 N/A INTRINSIC
low complexity region 187 210 N/A INTRINSIC
low complexity region 223 242 N/A INTRINSIC
low complexity region 292 305 N/A INTRINSIC
Pfam:zf-Sec23_Sec24 321 359 2.5e-18 PFAM
Pfam:Sec23_trunk 395 634 1.6e-87 PFAM
Pfam:Sec23_BS 639 723 2.2e-23 PFAM
Meta Mutation Damage Score 0.4939 question?
Coding Region Coverage
  • 1x: 98.0%
  • 3x: 96.8%
  • 10x: 93.2%
  • 20x: 83.7%
Validation Efficiency 97% (110/113)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC24 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein is thought to be a cargo-binding component of the COPII vesicle, and is thought to be involved in the transport of secretory proteins from the endoplasmic reticulum to the Golgi apparatus. Mutations in this gene have been associated with neural tube defects, and are thought to be a result of a disruption in interactions with the protein encoded by the VANGL planar cell polarity protein 2 (VANGL2) gene. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for an ENU induced mutation exhibit craniorachischisis, abnormal embryo shape, omphalocele, disoriented hair cells, and failure of eyelid fusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace A G 11: 105,973,880 probably null Het
Adgrg3 C T 8: 95,036,922 L284F probably benign Het
Alkbh8 T A 9: 3,385,469 V587E probably damaging Het
Ap4b1 T A 3: 103,818,839 C244S probably damaging Het
Ap4b1 T A 3: 103,821,396 M590K probably benign Het
Arhgap15 C T 2: 44,063,766 T168I probably damaging Het
Arntl2 T A 6: 146,822,655 H348Q probably damaging Het
Atp8b1 A G 18: 64,540,310 V997A probably damaging Het
Atrn G A 2: 130,906,859 C100Y probably damaging Het
Baiap2l2 C A 15: 79,271,216 A151S probably benign Het
Baz2b A T 2: 59,969,377 D199E possibly damaging Het
Cblb A G 16: 52,152,626 D440G probably benign Het
Cdon T C 9: 35,473,500 V694A probably benign Het
Cep250 A T 2: 155,992,349 R2065W probably damaging Het
Ces2b G T 8: 104,833,945 A131S probably damaging Het
Chrna9 A T 5: 65,967,892 T59S possibly damaging Het
Cog3 T A 14: 75,742,327 probably benign Het
Cpa1 G A 6: 30,641,857 V227I probably benign Het
Cyp3a25 A T 5: 145,998,513 C98S probably damaging Het
D8Ertd738e C T 8: 84,249,601 probably null Het
Ddx60 A G 8: 61,994,541 probably benign Het
Dhx16 T C 17: 35,883,050 probably null Het
Dnah9 T A 11: 66,084,789 Q1478L possibly damaging Het
Dock10 T C 1: 80,524,070 Y1434C possibly damaging Het
Enpp3 T A 10: 24,804,436 D325V probably damaging Het
Entpd6 C A 2: 150,760,170 T194K possibly damaging Het
Fam208b A T 13: 3,582,052 Y816* probably null Het
Fat2 A T 11: 55,270,349 V3185E probably benign Het
Flrt1 A G 19: 7,095,919 L421P probably benign Het
Fmn2 A T 1: 174,694,278 Q1292L probably damaging Het
Fndc1 T C 17: 7,775,588 probably null Het
Fndc1 T C 17: 7,753,723 D1459G probably damaging Het
Fzr1 A G 10: 81,369,368 S265P possibly damaging Het
Gm13119 A G 4: 144,362,646 N178S probably benign Het
Gm14085 T C 2: 122,521,854 L364S probably damaging Het
Gpr142 G A 11: 114,806,029 V134M probably damaging Het
Grid2ip G T 5: 143,357,620 V24L possibly damaging Het
Herc2 G A 7: 56,159,417 R2555H probably damaging Het
Hpdl A T 4: 116,820,479 Y262N possibly damaging Het
Htr3a A G 9: 48,908,659 V57A probably damaging Het
Igfbp7 T C 5: 77,355,591 I186V probably benign Het
Itga2b C T 11: 102,467,326 probably null Het
Itgae A C 11: 73,123,183 D736A possibly damaging Het
Itpkc T A 7: 27,208,345 M645L probably benign Het
Jchain T C 5: 88,521,378 R139G probably benign Het
Kif13a A G 13: 46,791,401 V908A probably damaging Het
Kif1b T A 4: 149,181,967 K389* probably null Het
Klhl12 T C 1: 134,485,856 Y360H possibly damaging Het
Knop1 G A 7: 118,853,053 R148W probably damaging Het
Lpar1 T A 4: 58,487,191 N27Y probably damaging Het
Lpar2 T A 8: 69,824,152 V197D probably damaging Het
Lrrc74a A G 12: 86,740,979 N128S probably damaging Het
Lum G T 10: 97,572,043 V337F probably benign Het
Mag T C 7: 30,906,980 D344G probably damaging Het
Maip1 G A 1: 57,407,196 A142T probably benign Het
Mlh3 A G 12: 85,268,968 V148A possibly damaging Het
Nav3 A G 10: 109,767,103 V1195A probably damaging Het
Ncor2 A G 5: 125,033,337 S868P possibly damaging Het
Nek1 A G 8: 61,106,855 E907G probably damaging Het
Nfam1 G A 15: 83,016,379 T134I probably benign Het
Nr0b2 T C 4: 133,553,759 V112A probably damaging Het
Nrp1 A G 8: 128,457,969 N365S probably damaging Het
Nrsn2 T C 2: 152,369,790 Y107C probably damaging Het
Ntng1 G A 3: 109,934,611 A282V probably damaging Het
Nxf1 T C 19: 8,765,028 I337T probably damaging Het
Obscn C T 11: 59,076,540 G479D probably damaging Het
Olfr45 T C 7: 140,691,309 S135P possibly damaging Het
Oprd1 T A 4: 132,113,768 D293V probably benign Het
P3h2 T G 16: 25,969,950 N586H possibly damaging Het
Pcid2 T C 8: 13,085,367 Y214C probably damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pkd1l3 G A 8: 109,623,663 S380N probably benign Het
Ppic C A 18: 53,411,071 G81W probably damaging Het
Ppp2r1a C A 17: 20,957,041 P246T probably damaging Het
Ppp4r4 T G 12: 103,584,102 S46A probably benign Het
Prkce A G 17: 86,168,653 T21A probably damaging Het
Prkg2 T C 5: 98,994,645 E210G possibly damaging Het
Prss35 A G 9: 86,756,037 M287V probably damaging Het
Psd G A 19: 46,320,972 probably benign Het
Ptch2 A T 4: 117,110,839 K843* probably null Het
Rab44 C A 17: 29,145,261 T603K probably damaging Het
Rasal3 T A 17: 32,392,790 probably null Het
Rbbp6 A G 7: 122,992,296 T526A probably damaging Het
Ros1 A T 10: 52,143,438 probably benign Het
Sema6a G A 18: 47,290,045 probably null Het
Setmar A T 6: 108,075,962 H139L probably benign Het
Slc4a7 T C 14: 14,766,808 V710A probably benign Het
Smarcc1 T A 9: 110,237,808 probably null Het
Smchd1 G A 17: 71,394,902 L1032F probably damaging Het
Speg T C 1: 75,430,784 probably benign Het
Tcea1 C G 1: 4,889,503 R134G probably benign Het
Tchhl1 C T 3: 93,471,029 Q347* probably null Het
Tecrl A T 5: 83,354,758 probably benign Het
Tepsin T C 11: 120,093,682 probably benign Het
Tmem40 G A 6: 115,733,985 probably benign Het
Tpr G A 1: 150,407,414 probably benign Het
Ttll12 A T 15: 83,580,658 probably benign Het
Ttn T A 2: 76,909,608 D3529V probably benign Het
Usp34 T A 11: 23,333,838 H177Q possibly damaging Het
Vsig10 T A 5: 117,338,461 S327T probably benign Het
Zbtb4 T A 11: 69,777,639 M396K probably damaging Het
Zfp352 C T 4: 90,225,009 T462I possibly damaging Het
Zfp385b T C 2: 77,476,845 M145V probably damaging Het
Zfp780b C A 7: 27,971,689 V65F possibly damaging Het
Other mutations in Sec24b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00984:Sec24b APN 3 130020646 intron probably benign
IGL01137:Sec24b APN 3 130007444 missense probably benign 0.02
IGL01370:Sec24b APN 3 130007604 splice site probably benign
IGL01931:Sec24b APN 3 130009799 missense probably benign 0.00
PIT4696001:Sec24b UTSW 3 129994391 missense probably benign 0.01
R0193:Sec24b UTSW 3 129988984 missense probably null
R0194:Sec24b UTSW 3 129984165 critical splice donor site probably null
R0403:Sec24b UTSW 3 129989676 missense possibly damaging 0.81
R0576:Sec24b UTSW 3 130041336 missense probably benign 0.11
R0583:Sec24b UTSW 3 130041311 nonsense probably null
R0963:Sec24b UTSW 3 130040905 missense probably benign 0.02
R0967:Sec24b UTSW 3 129996782 missense probably damaging 1.00
R1344:Sec24b UTSW 3 130007423 missense probably damaging 1.00
R1418:Sec24b UTSW 3 130007423 missense probably damaging 1.00
R1594:Sec24b UTSW 3 129991351 missense probably benign 0.00
R1716:Sec24b UTSW 3 130041016 missense possibly damaging 0.89
R1938:Sec24b UTSW 3 129991361 missense possibly damaging 0.82
R2020:Sec24b UTSW 3 129987728 missense probably damaging 1.00
R2407:Sec24b UTSW 3 130002316 missense probably benign 0.02
R2415:Sec24b UTSW 3 129996080 missense probably benign 0.00
R3121:Sec24b UTSW 3 130002304 critical splice donor site probably null
R3729:Sec24b UTSW 3 130033833 missense possibly damaging 0.95
R3731:Sec24b UTSW 3 130033833 missense possibly damaging 0.95
R3789:Sec24b UTSW 3 130020627 missense probably benign 0.00
R4229:Sec24b UTSW 3 130040719 missense probably benign 0.24
R4230:Sec24b UTSW 3 130040719 missense probably benign 0.24
R4617:Sec24b UTSW 3 130040764 missense possibly damaging 0.94
R4856:Sec24b UTSW 3 129983970 missense probably benign 0.07
R4886:Sec24b UTSW 3 129983970 missense probably benign 0.07
R4913:Sec24b UTSW 3 130002379 missense probably benign 0.07
R5510:Sec24b UTSW 3 130040895 missense probably damaging 1.00
R5601:Sec24b UTSW 3 130040834 small insertion probably benign
R6167:Sec24b UTSW 3 129988901 missense possibly damaging 0.88
R6314:Sec24b UTSW 3 130007245 unclassified probably null
R6442:Sec24b UTSW 3 129996701 missense probably damaging 1.00
R6512:Sec24b UTSW 3 130041297 missense probably damaging 1.00
R6743:Sec24b UTSW 3 130041232 missense probably damaging 0.98
R7081:Sec24b UTSW 3 129987742 missense probably benign 0.00
R7179:Sec24b UTSW 3 129988946 missense probably damaging 1.00
R7214:Sec24b UTSW 3 130033860 missense probably benign 0.19
R7332:Sec24b UTSW 3 130041393 missense probably benign 0.10
R7414:Sec24b UTSW 3 130009865 missense probably benign 0.01
R7599:Sec24b UTSW 3 130040811 small insertion probably benign
R7774:Sec24b UTSW 3 129984197 missense possibly damaging 0.88
R7895:Sec24b UTSW 3 129995949 missense probably benign 0.13
R7978:Sec24b UTSW 3 129995949 missense probably benign 0.13
X0065:Sec24b UTSW 3 129996355 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCAGCTTAGCCAGTCAGAGGGATAG -3'
(R):5'- TGACCCAGTGACGATAGTGACCAG -3'

Sequencing Primer
(F):5'- TTTGTGAATCAGATACCACGCC -3'
(R):5'- CGATAGTGACCAGGGCCTAAAG -3'
Posted On2013-05-09