Incidental Mutation 'R4746:Folr1'
ID356729
Institutional Source Beutler Lab
Gene Symbol Folr1
Ensembl Gene ENSMUSG00000001827
Gene Namefolate receptor 1 (adult)
SynonymsFolbp-1, folate receptor [a], Folbp1, folate-binding protein 1, FBP1
MMRRC Submission 041968-MU
Accession Numbers

Ncbi RefSeq: NM_001252552.1, NM_008034.3, NM_001252553.1, NM_001252554.1; MGI:95568

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4746 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location101858331-101870788 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 101863977 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 37 (D37V)
Ref Sequence ENSEMBL: ENSMUSP00000115077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106981] [ENSMUST00000106982] [ENSMUST00000106983] [ENSMUST00000106985] [ENSMUST00000106986] [ENSMUST00000123321] [ENSMUST00000123630] [ENSMUST00000124026] [ENSMUST00000126204] [ENSMUST00000134145] [ENSMUST00000140068] [ENSMUST00000140584] [ENSMUST00000150184] [ENSMUST00000151706] [ENSMUST00000155311] [ENSMUST00000209334]
Predicted Effect probably damaging
Transcript: ENSMUST00000001882
AA Change: D37V

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000001882
Gene: ENSMUSG00000001827
AA Change: D37V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Folate_rec 34 209 2.4e-61 PFAM
low complexity region 242 251 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106981
AA Change: D37V

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102594
Gene: ENSMUSG00000001827
AA Change: D37V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Folate_rec 34 209 2.4e-61 PFAM
low complexity region 242 251 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106982
AA Change: D37V

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102595
Gene: ENSMUSG00000001827
AA Change: D37V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Folate_rec 34 209 2.4e-61 PFAM
low complexity region 242 251 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106983
AA Change: D37V

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102596
Gene: ENSMUSG00000001827
AA Change: D37V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Folate_rec 34 209 4.2e-68 PFAM
low complexity region 242 251 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106985
AA Change: D37V

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102598
Gene: ENSMUSG00000001827
AA Change: D37V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Folate_rec 34 209 2.4e-61 PFAM
low complexity region 242 251 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106986
AA Change: D37V

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102599
Gene: ENSMUSG00000001827
AA Change: D37V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Folate_rec 34 209 2.4e-61 PFAM
low complexity region 242 251 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000123321
AA Change: D37V

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114167
Gene: ENSMUSG00000001827
AA Change: D37V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PDB:4LRH|H 21 54 6e-13 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000123630
AA Change: D37V

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121947
Gene: ENSMUSG00000001827
AA Change: D37V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PDB:4LRH|H 21 54 4e-13 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000124026
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125298
Predicted Effect probably damaging
Transcript: ENSMUST00000126204
AA Change: D37V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000117175
Gene: ENSMUSG00000001827
AA Change: D37V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Folate_rec 34 137 2.9e-38 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000134145
AA Change: D37V

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118547
Gene: ENSMUSG00000001827
AA Change: D37V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Folate_rec 34 104 2.6e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000140068
AA Change: D37V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000114633
Gene: ENSMUSG00000001827
AA Change: D37V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Folate_rec 34 160 9.5e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140584
Predicted Effect probably damaging
Transcript: ENSMUST00000150184
AA Change: D37V

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000151706
AA Change: D37V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115077
Gene: ENSMUSG00000001827
AA Change: D37V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Folate_rec 34 157 8.9e-47 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000155311
AA Change: D37V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000115360
Gene: ENSMUSG00000001827
AA Change: D37V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PDB:4LRH|H 21 53 3e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000209334
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype Strain: 2383986
Lethality: E8-E10
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the folate receptor family. Members of this gene family bind folic acid and its reduced derivatives, and transport 5-methyltetrahydrofolate into cells. This gene product is a secreted protein that either anchors to membranes via a glycosyl-phosphatidylinositol linkage or exists in a soluble form. Mutations in this gene have been associated with neurodegeneration due to cerebral folate transport deficiency. Due to the presence of two promoters, multiple transcription start sites, and alternative splicing, multiple transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Embryos homozygous for a knock-out allele are growth retarded and malformed, show multiple developmental anomalies, including neural and craniofacial defects, and die by E10. Folate supplementation of pregnant dams reduces embryonic mortality and improves many of the adverse developmental effects. [provided by MGI curators]
Allele List at MGI

All alleles(359) : Targeted(3) Gene trapped(356)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik G A 2: 152,440,765 S180N probably benign Het
Atp5a1 G T 18: 77,778,742 G165V probably benign Het
Cbfa2t2 A C 2: 154,523,925 M352L possibly damaging Het
Ccser2 A T 14: 36,909,125 D98E probably damaging Het
Cfap20 A G 8: 95,422,056 probably null Het
Chuk A T 19: 44,088,771 C379S possibly damaging Het
Cic G A 7: 25,288,480 G1531E probably damaging Het
Ckap4 A G 10: 84,533,520 V116A possibly damaging Het
Cxcl13 A G 5: 95,959,897 K71E probably damaging Het
Dmxl2 A T 9: 54,451,796 I210N probably benign Het
Donson A C 16: 91,682,237 V397G probably damaging Het
Dpy19l1 C A 9: 24,450,670 V332L probably benign Het
Dsp T C 13: 38,195,104 S1343P possibly damaging Het
Egflam A G 15: 7,224,639 probably null Het
Eif2b4 A G 5: 31,187,653 I550T probably damaging Het
Fbxo47 A T 11: 97,879,428 V46D probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gm17333 AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA 16: 77,852,878 noncoding transcript Het
Gnb1 C A 4: 155,543,074 A104E probably damaging Het
Gnptg ATTGTTGATGATTT AT 17: 25,235,597 probably benign Het
Htra4 A T 8: 25,033,697 V284E probably damaging Het
Igkv3-3 A T 6: 70,687,324 D50V probably benign Het
Irs3 A G 5: 137,643,947 S410P probably benign Het
Kif26b C T 1: 178,873,981 Q642* probably null Het
Klhl11 A T 11: 100,464,350 M215K probably benign Het
Lamc3 A G 2: 31,905,614 N337S possibly damaging Het
Lrrc55 G A 2: 85,196,170 A170V probably damaging Het
March3 A T 18: 56,776,072 W214R probably damaging Het
Megf11 A C 9: 64,508,745 T79P probably damaging Het
Mia3 A G 1: 183,345,220 V26A possibly damaging Het
Myrf A G 19: 10,218,591 F353S probably damaging Het
Obscn A G 11: 59,079,808 probably null Het
Ocstamp T C 2: 165,396,288 K352R probably benign Het
Olfr721-ps1 A T 14: 14,407,359 I46F probably benign Het
Olfr874 G T 9: 37,746,157 V8L probably benign Het
Osbpl3 T C 6: 50,328,674 N434S probably damaging Het
Pign A C 1: 105,585,024 L645V probably benign Het
Polr2a A G 11: 69,735,674 S1540P probably benign Het
Ppp2r3c A T 12: 55,302,635 probably null Het
Ptprf A G 4: 118,225,039 V414A possibly damaging Het
Pyroxd2 G A 19: 42,752,400 R22* probably null Het
Rab11fip2 G A 19: 59,937,110 A225V probably damaging Het
Ranbp2 C T 10: 58,492,670 A2836V probably damaging Het
Rimklb G A 6: 122,472,632 R28* probably null Het
Scyl3 G A 1: 163,949,251 R404Q probably damaging Het
Slc9a8 A T 2: 167,441,170 K79* probably null Het
Sowaha A T 11: 53,479,336 probably null Het
Tnk1 A G 11: 69,855,166 V311A probably damaging Het
Tnrc6a T A 7: 123,189,997 S1680T probably damaging Het
Tpp1 T C 7: 105,748,951 Y335C probably damaging Het
Ttc39b A G 4: 83,244,103 V308A probably benign Het
Ttll3 A C 6: 113,407,392 Q557P probably damaging Het
Ulk3 G A 9: 57,592,918 A266T probably benign Het
Wfdc6b C A 2: 164,617,433 C138* probably null Het
Znrd1as A T 17: 36,964,873 I116L probably benign Het
Other mutations in Folr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01916:Folr1 APN 7 101858740 missense probably benign 0.00
IGL02423:Folr1 APN 7 101858525 missense probably benign 0.00
R0071:Folr1 UTSW 7 101863923 critical splice donor site probably null
R0071:Folr1 UTSW 7 101863923 critical splice donor site probably null
R1022:Folr1 UTSW 7 101858603 missense probably damaging 0.98
R1024:Folr1 UTSW 7 101858603 missense probably damaging 0.98
R1562:Folr1 UTSW 7 101858594 missense probably damaging 0.98
R2299:Folr1 UTSW 7 101863992 missense probably damaging 1.00
R3690:Folr1 UTSW 7 101858538 missense probably benign 0.06
R4747:Folr1 UTSW 7 101863977 missense probably damaging 1.00
R5319:Folr1 UTSW 7 101863977 missense probably damaging 1.00
R6243:Folr1 UTSW 7 101863965 missense probably damaging 1.00
R6275:Folr1 UTSW 7 101859535 missense probably damaging 0.99
R7284:Folr1 UTSW 7 101859470 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- GCTACCAGGAAGATGAGCTG -3'
(R):5'- TGGAGCTGAGCACACACTTG -3'

Sequencing Primer
(F):5'- ATATCACACTGGCAGTTGGC -3'
(R):5'- TGAGCACACACTTGGAGGTTC -3'
Posted On2015-11-11