Incidental Mutation 'R4746:Tpp1'
ID356730
Institutional Source Beutler Lab
Gene Symbol Tpp1
Ensembl Gene ENSMUSG00000030894
Gene Nametripeptidyl peptidase I
SynonymsCln2
MMRRC Submission 041968-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4746 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location105744811-105752235 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105748951 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 335 (Y335C)
Ref Sequence ENSEMBL: ENSMUSP00000033184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033184] [ENSMUST00000078482] [ENSMUST00000141116] [ENSMUST00000210066]
Predicted Effect probably damaging
Transcript: ENSMUST00000033184
AA Change: Y335C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033184
Gene: ENSMUSG00000030894
AA Change: Y335C

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pro-kuma_activ 32 176 4.53e-50 SMART
low complexity region 177 189 N/A INTRINSIC
Pfam:Peptidase_S8 251 492 1.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000054556
Predicted Effect probably benign
Transcript: ENSMUST00000078482
SMART Domains Protein: ENSMUSP00000077574
Gene: ENSMUSG00000036862

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
CA 58 135 5.2e-11 SMART
CA 159 247 6.1e-17 SMART
CA 271 354 2.6e-30 SMART
CA 382 464 7.8e-26 SMART
CA 489 570 1.2e-34 SMART
CA 594 677 1.9e-27 SMART
CA 701 782 5.3e-11 SMART
CA 806 886 1e-12 SMART
CA 910 990 3.3e-14 SMART
CA 1016 1097 3.6e-18 SMART
CA 1121 1203 3.1e-34 SMART
CA 1233 1307 8.8e-16 SMART
low complexity region 1323 1335 N/A INTRINSIC
CA 1344 1427 9.9e-9 SMART
CA 1451 1537 1.5e-23 SMART
CA 1560 1640 7.2e-32 SMART
CA 1664 1742 1.8e-31 SMART
CA 1765 1846 7.8e-30 SMART
CA 1870 1951 3.7e-26 SMART
low complexity region 1957 1965 N/A INTRINSIC
CA 1979 2059 1.1e-6 SMART
CA 2083 2162 2.7e-18 SMART
CA 2186 2268 2.2e-26 SMART
CA 2291 2367 1e-18 SMART
CA 2391 2473 1.8e-23 SMART
CA 2497 2593 3.5e-21 SMART
CA 2617 2697 1.2e-25 SMART
CA 2721 2804 1.9e-18 SMART
CA 2828 2919 3e-3 SMART
transmembrane domain 2932 2954 N/A INTRINSIC
low complexity region 3001 3017 N/A INTRINSIC
low complexity region 3046 3055 N/A INTRINSIC
low complexity region 3088 3097 N/A INTRINSIC
low complexity region 3185 3196 N/A INTRINSIC
low complexity region 3237 3259 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131683
Predicted Effect probably benign
Transcript: ENSMUST00000141116
SMART Domains Protein: ENSMUSP00000118105
Gene: ENSMUSG00000043866

DomainStartEndE-ValueType
low complexity region 17 39 N/A INTRINSIC
low complexity region 45 91 N/A INTRINSIC
Pfam:TFIID_30kDa 128 177 6.1e-30 PFAM
low complexity region 181 192 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210018
Predicted Effect probably benign
Transcript: ENSMUST00000210066
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210395
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210730
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210840
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211204
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211560
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211659
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a lysosomal serine protease that cleaves N-terminal tripeptides from protein substrates. The encoded preproprotein undergoes autocatalytic processing to generate a mature enzyme. Mice lacking the encoded protein exhibit a progressive neurodegeneration and a greatly shortened lifespan. At the cellular level, mice lacking the encoded protein exhibit accumulation of autofluorescent lipopigments. Mutations in the human ortholog of this gene cause classical late-infantile neuronal ceroid lipofuscinosis. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for targeted mutations exhibit progressive motor defects, reduced lifespan, and respiratory difficulty. One mutation also shows extensive neuronal degeneration and an accumulation of lysosomal storage material. Mice homozygous for a different allele exhibit prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik G A 2: 152,440,765 S180N probably benign Het
Atp5a1 G T 18: 77,778,742 G165V probably benign Het
Cbfa2t2 A C 2: 154,523,925 M352L possibly damaging Het
Ccser2 A T 14: 36,909,125 D98E probably damaging Het
Cfap20 A G 8: 95,422,056 probably null Het
Chuk A T 19: 44,088,771 C379S possibly damaging Het
Cic G A 7: 25,288,480 G1531E probably damaging Het
Ckap4 A G 10: 84,533,520 V116A possibly damaging Het
Cxcl13 A G 5: 95,959,897 K71E probably damaging Het
Dmxl2 A T 9: 54,451,796 I210N probably benign Het
Donson A C 16: 91,682,237 V397G probably damaging Het
Dpy19l1 C A 9: 24,450,670 V332L probably benign Het
Dsp T C 13: 38,195,104 S1343P possibly damaging Het
Egflam A G 15: 7,224,639 probably null Het
Eif2b4 A G 5: 31,187,653 I550T probably damaging Het
Fbxo47 A T 11: 97,879,428 V46D probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Folr1 T A 7: 101,863,977 D37V probably damaging Het
Gm17333 AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA 16: 77,852,878 noncoding transcript Het
Gnb1 C A 4: 155,543,074 A104E probably damaging Het
Gnptg ATTGTTGATGATTT AT 17: 25,235,597 probably benign Het
Htra4 A T 8: 25,033,697 V284E probably damaging Het
Igkv3-3 A T 6: 70,687,324 D50V probably benign Het
Irs3 A G 5: 137,643,947 S410P probably benign Het
Kif26b C T 1: 178,873,981 Q642* probably null Het
Klhl11 A T 11: 100,464,350 M215K probably benign Het
Lamc3 A G 2: 31,905,614 N337S possibly damaging Het
Lrrc55 G A 2: 85,196,170 A170V probably damaging Het
March3 A T 18: 56,776,072 W214R probably damaging Het
Megf11 A C 9: 64,508,745 T79P probably damaging Het
Mia3 A G 1: 183,345,220 V26A possibly damaging Het
Myrf A G 19: 10,218,591 F353S probably damaging Het
Obscn A G 11: 59,079,808 probably null Het
Ocstamp T C 2: 165,396,288 K352R probably benign Het
Olfr721-ps1 A T 14: 14,407,359 I46F probably benign Het
Olfr874 G T 9: 37,746,157 V8L probably benign Het
Osbpl3 T C 6: 50,328,674 N434S probably damaging Het
Pign A C 1: 105,585,024 L645V probably benign Het
Polr2a A G 11: 69,735,674 S1540P probably benign Het
Ppp2r3c A T 12: 55,302,635 probably null Het
Ptprf A G 4: 118,225,039 V414A possibly damaging Het
Pyroxd2 G A 19: 42,752,400 R22* probably null Het
Rab11fip2 G A 19: 59,937,110 A225V probably damaging Het
Ranbp2 C T 10: 58,492,670 A2836V probably damaging Het
Rimklb G A 6: 122,472,632 R28* probably null Het
Scyl3 G A 1: 163,949,251 R404Q probably damaging Het
Slc9a8 A T 2: 167,441,170 K79* probably null Het
Sowaha A T 11: 53,479,336 probably null Het
Tnk1 A G 11: 69,855,166 V311A probably damaging Het
Tnrc6a T A 7: 123,189,997 S1680T probably damaging Het
Ttc39b A G 4: 83,244,103 V308A probably benign Het
Ttll3 A C 6: 113,407,392 Q557P probably damaging Het
Ulk3 G A 9: 57,592,918 A266T probably benign Het
Wfdc6b C A 2: 164,617,433 C138* probably null Het
Znrd1as A T 17: 36,964,873 I116L probably benign Het
Other mutations in Tpp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01480:Tpp1 APN 7 105749053 missense probably damaging 1.00
IGL01520:Tpp1 APN 7 105747729 missense probably benign 0.32
IGL01796:Tpp1 APN 7 105747650 unclassified probably benign
IGL01797:Tpp1 APN 7 105749252 missense probably benign 0.07
IGL01923:Tpp1 APN 7 105751650 missense probably benign 0.34
IGL02400:Tpp1 APN 7 105747031 missense possibly damaging 0.91
IGL02411:Tpp1 APN 7 105749619 missense probably damaging 1.00
IGL02423:Tpp1 APN 7 105749700 missense probably damaging 1.00
IGL02672:Tpp1 APN 7 105746961 missense probably benign
IGL03180:Tpp1 APN 7 105746649 missense probably benign
R0709:Tpp1 UTSW 7 105749607 missense probably benign 0.19
R0711:Tpp1 UTSW 7 105749419 missense probably damaging 1.00
R1222:Tpp1 UTSW 7 105746741 missense probably benign 0.05
R1673:Tpp1 UTSW 7 105747673 missense probably damaging 0.99
R1799:Tpp1 UTSW 7 105750308 missense probably benign 0.00
R1822:Tpp1 UTSW 7 105749647 missense probably benign
R1984:Tpp1 UTSW 7 105751698 missense probably benign 0.04
R2109:Tpp1 UTSW 7 105749970 missense probably damaging 1.00
R4304:Tpp1 UTSW 7 105750309 missense possibly damaging 0.70
R4618:Tpp1 UTSW 7 105751706 missense probably benign 0.05
R4764:Tpp1 UTSW 7 105749251 missense probably damaging 1.00
R4837:Tpp1 UTSW 7 105746649 missense probably benign
R4855:Tpp1 UTSW 7 105746723 missense probably benign
R5015:Tpp1 UTSW 7 105752025 unclassified probably benign
R5677:Tpp1 UTSW 7 105747536 missense probably damaging 1.00
R5916:Tpp1 UTSW 7 105749380 missense probably damaging 0.97
R6149:Tpp1 UTSW 7 105747727 missense probably benign 0.00
R6291:Tpp1 UTSW 7 105747016 missense probably benign 0.05
R6422:Tpp1 UTSW 7 105746956 missense probably benign 0.01
R6671:Tpp1 UTSW 7 105749607 missense probably benign 0.19
R6841:Tpp1 UTSW 7 105748964 missense probably damaging 0.96
R6851:Tpp1 UTSW 7 105749712 missense probably damaging 1.00
R7022:Tpp1 UTSW 7 105748922 missense probably damaging 1.00
R7106:Tpp1 UTSW 7 105749911 missense possibly damaging 0.67
R7260:Tpp1 UTSW 7 105747497 missense probably benign 0.00
R7485:Tpp1 UTSW 7 105749544 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCACCTCAGAGTACTCAG -3'
(R):5'- TGAAGGGAGATTCTAGCAACCATC -3'

Sequencing Primer
(F):5'- AGACCCTGTTAAGGCTCTGAG -3'
(R):5'- GGGAGATTCTAGCAACCATCCAATG -3'
Posted On2015-11-11