Mutagenetix > Incidental Mutations

Incidental Mutation 'R4746:Olfr874'

356735

Institutional Source

Beutler Lab

Gene Symbol

Olfr874

Ensembl Gene

ENSMUSG00000063350

Gene Name

olfactory receptor 874

Synonyms

MOR161-2, GA_x6K02T2PVTD-31428850-31429782

MMRRC Submission

041968-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.062) question?

Stock #

R4746 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

37745106-37748594 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 37746157 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 8 (V8L)

Ref Sequence

ENSEMBL: ENSMUSP00000150088 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115004] [ENSMUST00000216982]

Predicted Effect

probably benign
Transcript: ENSMUST00000115004
AA Change: V8L

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000110656
Gene: ENSMUSG00000063350
AA Change: V8L

Domain	Start	End	E-Value	Type
Pfam:7tm_4	30	307	5.9e-49	PFAM
Pfam:7tm_1	40	289	6.2e-22	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000216982
AA Change: V8L

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6820408C15Rik	G	A	2: 152,440,765	S180N	probably benign	Het
Atp5a1	G	T	18: 77,778,742	G165V	probably benign	Het
Cbfa2t2	A	C	2: 154,523,925	M352L	possibly damaging	Het
Ccser2	A	T	14: 36,909,125	D98E	probably damaging	Het
Cfap20	A	G	8: 95,422,056		probably null	Het
Chuk	A	T	19: 44,088,771	C379S	possibly damaging	Het
Cic	G	A	7: 25,288,480	G1531E	probably damaging	Het
Ckap4	A	G	10: 84,533,520	V116A	possibly damaging	Het
Cxcl13	A	G	5: 95,959,897	K71E	probably damaging	Het
Dmxl2	A	T	9: 54,451,796	I210N	probably benign	Het
Donson	A	C	16: 91,682,237	V397G	probably damaging	Het
Dpy19l1	C	A	9: 24,450,670	V332L	probably benign	Het
Dsp	T	C	13: 38,195,104	S1343P	possibly damaging	Het
Egflam	A	G	15: 7,224,639		probably null	Het
Eif2b4	A	G	5: 31,187,653	I550T	probably damaging	Het
Fbxo47	A	T	11: 97,879,428	V46D	probably benign	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Folr1	T	A	7: 101,863,977	D37V	probably damaging	Het
Gm17333	AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA	AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA	16: 77,852,878		noncoding transcript	Het
Gnb1	C	A	4: 155,543,074	A104E	probably damaging	Het
Gnptg	ATTGTTGATGATTT	AT	17: 25,235,597		probably benign	Het
Htra4	A	T	8: 25,033,697	V284E	probably damaging	Het
Igkv3-3	A	T	6: 70,687,324	D50V	probably benign	Het
Irs3	A	G	5: 137,643,947	S410P	probably benign	Het
Kif26b	C	T	1: 178,873,981	Q642*	probably null	Het
Klhl11	A	T	11: 100,464,350	M215K	probably benign	Het
Lamc3	A	G	2: 31,905,614	N337S	possibly damaging	Het
Lrrc55	G	A	2: 85,196,170	A170V	probably damaging	Het
March3	A	T	18: 56,776,072	W214R	probably damaging	Het
Megf11	A	C	9: 64,508,745	T79P	probably damaging	Het
Mia3	A	G	1: 183,345,220	V26A	possibly damaging	Het
Myrf	A	G	19: 10,218,591	F353S	probably damaging	Het
Obscn	A	G	11: 59,079,808		probably null	Het
Ocstamp	T	C	2: 165,396,288	K352R	probably benign	Het
Olfr721-ps1	A	T	14: 14,407,359	I46F	probably benign	Het
Osbpl3	T	C	6: 50,328,674	N434S	probably damaging	Het
Pign	A	C	1: 105,585,024	L645V	probably benign	Het
Polr2a	A	G	11: 69,735,674	S1540P	probably benign	Het
Ppp2r3c	A	T	12: 55,302,635		probably null	Het
Ptprf	A	G	4: 118,225,039	V414A	possibly damaging	Het
Pyroxd2	G	A	19: 42,752,400	R22*	probably null	Het
Rab11fip2	G	A	19: 59,937,110	A225V	probably damaging	Het
Ranbp2	C	T	10: 58,492,670	A2836V	probably damaging	Het
Rimklb	G	A	6: 122,472,632	R28*	probably null	Het
Scyl3	G	A	1: 163,949,251	R404Q	probably damaging	Het
Slc9a8	A	T	2: 167,441,170	K79*	probably null	Het
Sowaha	A	T	11: 53,479,336		probably null	Het
Tnk1	A	G	11: 69,855,166	V311A	probably damaging	Het
Tnrc6a	T	A	7: 123,189,997	S1680T	probably damaging	Het
Tpp1	T	C	7: 105,748,951	Y335C	probably damaging	Het
Ttc39b	A	G	4: 83,244,103	V308A	probably benign	Het
Ttll3	A	C	6: 113,407,392	Q557P	probably damaging	Het
Ulk3	G	A	9: 57,592,918	A266T	probably benign	Het
Wfdc6b	C	A	2: 164,617,433	C138*	probably null	Het
Znrd1as	A	T	17: 36,964,873	I116L	probably benign	Het

Other mutations in Olfr874

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00158:Olfr874	APN	9	37746389	missense	possibly damaging	0.89
IGL02349:Olfr874	APN	9	37746206	missense	probably benign	0.03
IGL02799:Olfr874	UTSW	9	37746509	missense	probably damaging	1.00
R0498:Olfr874	UTSW	9	37746254	missense	probably damaging	1.00
R0690:Olfr874	UTSW	9	37746217	missense	probably benign	0.01
R1053:Olfr874	UTSW	9	37746835	missense	probably damaging	0.99
R1777:Olfr874	UTSW	9	37746311	missense	possibly damaging	0.78
R1862:Olfr874	UTSW	9	37746968	missense	probably benign
R1907:Olfr874	UTSW	9	37746433	missense	probably benign	0.35
R4524:Olfr874	UTSW	9	37746866	missense	possibly damaging	0.50
R4731:Olfr874	UTSW	9	37746535	missense	probably benign	0.06
R4768:Olfr874	UTSW	9	37746881	missense	probably damaging	1.00
R5130:Olfr874	UTSW	9	37746509	missense	probably damaging	1.00
R5406:Olfr874	UTSW	9	37746647	missense	probably benign	0.23
R5546:Olfr874	UTSW	9	37746524	missense	probably benign	0.05
R5882:Olfr874	UTSW	9	37746632	missense	probably benign	0.02
R5946:Olfr874	UTSW	9	37747034	missense	probably damaging	0.99
R6226:Olfr874	UTSW	9	37746137	start codon destroyed	probably null	1.00
R6705:Olfr874	UTSW	9	37746734	missense	possibly damaging	0.94
R6965:Olfr874	UTSW	9	37746137	start codon destroyed	probably null	1.00
R8008:Olfr874	UTSW	9	37746793	missense	probably damaging	0.99
R8743:Olfr874	UTSW	9	37746878	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GCATCTCAAACGGACTAACTTC -3'
(R):5'- ACCCTGAGTGTGAGATGATGTTC -3'

Sequencing Primer
(F):5'- ACGGACTAACTTCAGAATCTAAGAG -3'
(R):5'- TTTTGGGATGATAGTGGAGGAATAAC -3'

Posted On

2015-11-11