Incidental Mutation 'R4746:Ulk3'
ID356738
Institutional Source Beutler Lab
Gene Symbol Ulk3
Ensembl Gene ENSMUSG00000032308
Gene Nameunc-51-like kinase 3
Synonyms
MMRRC Submission 041968-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4746 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location57589452-57596233 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 57592918 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 266 (A266T)
Ref Sequence ENSEMBL: ENSMUSP00000059947 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045791] [ENSMUST00000053230] [ENSMUST00000215748]
Predicted Effect probably benign
Transcript: ENSMUST00000045791
SMART Domains Protein: ENSMUSP00000038350
Gene: ENSMUSG00000040188

DomainStartEndE-ValueType
low complexity region 69 83 N/A INTRINSIC
low complexity region 94 106 N/A INTRINSIC
Pfam:SCAMP 117 293 2.6e-68 PFAM
low complexity region 309 328 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000053230
AA Change: A266T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000059947
Gene: ENSMUSG00000032308
AA Change: A266T

DomainStartEndE-ValueType
S_TKc 14 270 4.74e-98 SMART
MIT 277 354 1.1e-10 SMART
MIT 372 450 2.96e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213212
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213530
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215146
Predicted Effect probably benign
Transcript: ENSMUST00000215748
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215868
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217100
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik G A 2: 152,440,765 S180N probably benign Het
Atp5a1 G T 18: 77,778,742 G165V probably benign Het
Cbfa2t2 A C 2: 154,523,925 M352L possibly damaging Het
Ccser2 A T 14: 36,909,125 D98E probably damaging Het
Cfap20 A G 8: 95,422,056 probably null Het
Chuk A T 19: 44,088,771 C379S possibly damaging Het
Cic G A 7: 25,288,480 G1531E probably damaging Het
Ckap4 A G 10: 84,533,520 V116A possibly damaging Het
Cxcl13 A G 5: 95,959,897 K71E probably damaging Het
Dmxl2 A T 9: 54,451,796 I210N probably benign Het
Donson A C 16: 91,682,237 V397G probably damaging Het
Dpy19l1 C A 9: 24,450,670 V332L probably benign Het
Dsp T C 13: 38,195,104 S1343P possibly damaging Het
Egflam A G 15: 7,224,639 probably null Het
Eif2b4 A G 5: 31,187,653 I550T probably damaging Het
Fbxo47 A T 11: 97,879,428 V46D probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Folr1 T A 7: 101,863,977 D37V probably damaging Het
Gm17333 AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA 16: 77,852,878 noncoding transcript Het
Gnb1 C A 4: 155,543,074 A104E probably damaging Het
Gnptg ATTGTTGATGATTT AT 17: 25,235,597 probably benign Het
Htra4 A T 8: 25,033,697 V284E probably damaging Het
Igkv3-3 A T 6: 70,687,324 D50V probably benign Het
Irs3 A G 5: 137,643,947 S410P probably benign Het
Kif26b C T 1: 178,873,981 Q642* probably null Het
Klhl11 A T 11: 100,464,350 M215K probably benign Het
Lamc3 A G 2: 31,905,614 N337S possibly damaging Het
Lrrc55 G A 2: 85,196,170 A170V probably damaging Het
March3 A T 18: 56,776,072 W214R probably damaging Het
Megf11 A C 9: 64,508,745 T79P probably damaging Het
Mia3 A G 1: 183,345,220 V26A possibly damaging Het
Myrf A G 19: 10,218,591 F353S probably damaging Het
Obscn A G 11: 59,079,808 probably null Het
Ocstamp T C 2: 165,396,288 K352R probably benign Het
Olfr721-ps1 A T 14: 14,407,359 I46F probably benign Het
Olfr874 G T 9: 37,746,157 V8L probably benign Het
Osbpl3 T C 6: 50,328,674 N434S probably damaging Het
Pign A C 1: 105,585,024 L645V probably benign Het
Polr2a A G 11: 69,735,674 S1540P probably benign Het
Ppp2r3c A T 12: 55,302,635 probably null Het
Ptprf A G 4: 118,225,039 V414A possibly damaging Het
Pyroxd2 G A 19: 42,752,400 R22* probably null Het
Rab11fip2 G A 19: 59,937,110 A225V probably damaging Het
Ranbp2 C T 10: 58,492,670 A2836V probably damaging Het
Rimklb G A 6: 122,472,632 R28* probably null Het
Scyl3 G A 1: 163,949,251 R404Q probably damaging Het
Slc9a8 A T 2: 167,441,170 K79* probably null Het
Sowaha A T 11: 53,479,336 probably null Het
Tnk1 A G 11: 69,855,166 V311A probably damaging Het
Tnrc6a T A 7: 123,189,997 S1680T probably damaging Het
Tpp1 T C 7: 105,748,951 Y335C probably damaging Het
Ttc39b A G 4: 83,244,103 V308A probably benign Het
Ttll3 A C 6: 113,407,392 Q557P probably damaging Het
Wfdc6b C A 2: 164,617,433 C138* probably null Het
Znrd1as A T 17: 36,964,873 I116L probably benign Het
Other mutations in Ulk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0023:Ulk3 UTSW 9 57590356 nonsense probably null
R0164:Ulk3 UTSW 9 57590686 missense probably damaging 1.00
R0164:Ulk3 UTSW 9 57590686 missense probably damaging 1.00
R0334:Ulk3 UTSW 9 57594227 unclassified probably benign
R0391:Ulk3 UTSW 9 57594832 missense probably benign
R1635:Ulk3 UTSW 9 57593160 critical splice acceptor site probably null
R2696:Ulk3 UTSW 9 57590441 missense possibly damaging 0.63
R3689:Ulk3 UTSW 9 57593794 missense probably benign 0.44
R4151:Ulk3 UTSW 9 57592367 missense possibly damaging 0.64
R4502:Ulk3 UTSW 9 57593229 missense probably damaging 1.00
R4586:Ulk3 UTSW 9 57594310 missense possibly damaging 0.81
R5034:Ulk3 UTSW 9 57593764 missense possibly damaging 0.88
R5288:Ulk3 UTSW 9 57590740 missense possibly damaging 0.81
R5385:Ulk3 UTSW 9 57590740 missense possibly damaging 0.81
R5386:Ulk3 UTSW 9 57590740 missense possibly damaging 0.81
R7480:Ulk3 UTSW 9 57591240 nonsense probably null
R7581:Ulk3 UTSW 9 57592042 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCAAACACGTACCCTTATGG -3'
(R):5'- TACCTTCCTAATGCCACAGC -3'

Sequencing Primer
(F):5'- CTTATGGGGGTTCCTAACAGGCC -3'
(R):5'- GCAAGTAGCATCAGTCAGCAATC -3'
Posted On2015-11-11