Mutagenetix > Incidental Mutations

Incidental Mutation 'R4746:Polr2a'

356743

Institutional Source

Beutler Lab

Gene Symbol

Polr2a

Ensembl Gene

ENSMUSG00000005198

Gene Name

polymerase (RNA) II (DNA directed) polypeptide A

Synonyms

Rpo2-1, 220kDa

MMRRC Submission

041968-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.967) question?

Stock #

R4746 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

69733997-69758637 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 69735674 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1540 (S1540P)

Ref Sequence

ENSEMBL: ENSMUSP00000071200 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058470] [ENSMUST00000071213]

Predicted Effect

probably benign
Transcript: ENSMUST00000058470
AA Change: S1578P

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000050771
Gene: ENSMUSG00000005198
AA Change: S1578P

Domain	Start	End	E-Value	Type
Blast:RPOLA_N	110	179	5e-37	BLAST
RPOLA_N	246	549	7.02e-203	SMART
Pfam:RNA_pol_Rpb1_4	716	823	3.6e-39	PFAM
Pfam:RNA_pol_Rpb1_5	830	1428	2e-101	PFAM
Pfam:RNA_pol_Rpb1_6	896	1079	1.7e-70	PFAM
Pfam:RNA_pol_Rpb1_7	1164	1299	1.7e-57	PFAM
Pfam:RNA_pol_Rpb1_R	1555	1568	2.1e-3	PFAM
Pfam:RNA_pol_Rpb1_R	1616	1629	8.8e-4	PFAM
Pfam:RNA_pol_Rpb1_R	1630	1643	1.9e-5	PFAM
Pfam:RNA_pol_Rpb1_R	1644	1657	2.3e-4	PFAM
Pfam:RNA_pol_Rpb1_R	1658	1671	2.2e-4	PFAM
Pfam:RNA_pol_Rpb1_R	1672	1685	2.4e-4	PFAM
Pfam:RNA_pol_Rpb1_R	1686	1699	2.5e-4	PFAM
Pfam:RNA_pol_Rpb1_R	1700	1713	2.5e-4	PFAM
Pfam:RNA_pol_Rpb1_R	1714	1727	2.5e-4	PFAM
Pfam:RNA_pol_Rpb1_R	1728	1741	2.6e-4	PFAM
Pfam:RNA_pol_Rpb1_R	1742	1755	5.3e-6	PFAM
Pfam:RNA_pol_Rpb1_R	1757	1769	5.8e-4	PFAM
Pfam:RNA_pol_Rpb1_R	1784	1797	2.6e-4	PFAM
Pfam:RNA_pol_Rpb1_R	1798	1811	4.8e-4	PFAM
Pfam:RNA_pol_Rpb1_R	1826	1839	4.3e-4	PFAM
Pfam:RNA_pol_Rpb1_R	1841	1853	2e-3	PFAM
Pfam:RNA_pol_Rpb1_R	1854	1867	6.9e-6	PFAM
Pfam:RNA_pol_Rpb1_R	1868	1881	3.7e-6	PFAM
Pfam:RNA_pol_Rpb1_R	1882	1895	1.2e-4	PFAM
Pfam:RNA_pol_Rpb1_R	1896	1909	5e-6	PFAM
Pfam:RNA_pol_Rpb1_R	1910	1923	2.5e-5	PFAM
Pfam:RNA_pol_Rpb1_R	1924	1936	2e-4	PFAM
Pfam:RNA_pol_Rpb1_R	1931	1954	2.6e-3	PFAM
Pfam:RNA_pol_Rpb1_R	1948	1960	2.5e-3	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000071213
AA Change: S1540P

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000071200
Gene: ENSMUSG00000005198
AA Change: S1540P

Domain	Start	End	E-Value	Type
Blast:RPOLA_N	110	179	5e-37	BLAST
RPOLA_N	246	549	7.02e-203	SMART
Pfam:RNA_pol_Rpb1_4	716	823	1.8e-41	PFAM
Pfam:RNA_pol_Rpb1_5	830	1428	4.8e-104	PFAM
Pfam:RNA_pol_Rpb1_6	896	1079	5.2e-74	PFAM
Pfam:RNA_pol_Rpb1_7	1164	1299	1.4e-55	PFAM
low complexity region	1503	1522	N/A	INTRINSIC
low complexity region	1524	1549	N/A	INTRINSIC
Pfam:RNA_pol_Rpb1_R	1578	1591	2.7e-5	PFAM
Pfam:RNA_pol_Rpb1_R	1592	1605	2.5e-6	PFAM
Pfam:RNA_pol_Rpb1_R	1606	1619	2.7e-5	PFAM
Pfam:RNA_pol_Rpb1_R	1620	1633	2.5e-5	PFAM
Pfam:RNA_pol_Rpb1_R	1634	1647	2.5e-5	PFAM
Pfam:RNA_pol_Rpb1_R	1648	1661	2.4e-5	PFAM
Pfam:RNA_pol_Rpb1_R	1662	1675	2.4e-5	PFAM
Pfam:RNA_pol_Rpb1_R	1676	1689	2.6e-5	PFAM
Pfam:RNA_pol_Rpb1_R	1690	1703	2.3e-5	PFAM
Pfam:RNA_pol_Rpb1_R	1704	1717	5.2e-7	PFAM
Pfam:RNA_pol_Rpb1_R	1718	1731	5.5e-5	PFAM
Pfam:RNA_pol_Rpb1_R	1732	1745	1.6e-5	PFAM
Pfam:RNA_pol_Rpb1_R	1746	1759	8.6e-5	PFAM
Pfam:RNA_pol_Rpb1_R	1760	1773	2e-4	PFAM
Pfam:RNA_pol_Rpb1_R	1788	1801	3.3e-5	PFAM
Pfam:RNA_pol_Rpb1_R	1802	1815	2.4e-4	PFAM
Pfam:RNA_pol_Rpb1_R	1816	1829	8.3e-7	PFAM
Pfam:RNA_pol_Rpb1_R	1830	1843	2.2e-6	PFAM
Pfam:RNA_pol_Rpb1_R	1844	1857	1.6e-5	PFAM
Pfam:RNA_pol_Rpb1_R	1858	1871	2.8e-6	PFAM
Pfam:RNA_pol_Rpb1_R	1872	1885	6e-7	PFAM
Pfam:RNA_pol_Rpb1_R	1886	1899	4.6e-6	PFAM
Pfam:RNA_pol_Rpb1_R	1893	1909	4.8e-5	PFAM
Pfam:RNA_pol_Rpb1_R	1903	1916	2.8e-6	PFAM
Pfam:RNA_pol_Rpb1_R	1910	1923	1.6e-4	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156588

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the largest subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. The product of this gene contains a carboxy terminal domain composed of heptapeptide repeats that are essential for polymerase activity. These repeats contain serine and threonine residues that are phosphorylated in actively transcribing RNA polymerase. In addition, this subunit, in combination with several other polymerase subunits, forms the DNA binding domain of the polymerase, a groove in which the DNA template is transcribed into RNA. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a reporter allele show prenatal lethality. Homozygotes for a small deletion in the C-terminal domain are viable, fertile and developmentally normal. Homozygotes for a larger deletion show reduced fetal size and partial postnatal lethality; survivors are small but otherwise normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6820408C15Rik	G	A	2: 152,440,765	S180N	probably benign	Het
Atp5a1	G	T	18: 77,778,742	G165V	probably benign	Het
Cbfa2t2	A	C	2: 154,523,925	M352L	possibly damaging	Het
Ccser2	A	T	14: 36,909,125	D98E	probably damaging	Het
Cfap20	A	G	8: 95,422,056		probably null	Het
Chuk	A	T	19: 44,088,771	C379S	possibly damaging	Het
Cic	G	A	7: 25,288,480	G1531E	probably damaging	Het
Ckap4	A	G	10: 84,533,520	V116A	possibly damaging	Het
Cxcl13	A	G	5: 95,959,897	K71E	probably damaging	Het
Dmxl2	A	T	9: 54,451,796	I210N	probably benign	Het
Donson	A	C	16: 91,682,237	V397G	probably damaging	Het
Dpy19l1	C	A	9: 24,450,670	V332L	probably benign	Het
Dsp	T	C	13: 38,195,104	S1343P	possibly damaging	Het
Egflam	A	G	15: 7,224,639		probably null	Het
Eif2b4	A	G	5: 31,187,653	I550T	probably damaging	Het
Fbxo47	A	T	11: 97,879,428	V46D	probably benign	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Folr1	T	A	7: 101,863,977	D37V	probably damaging	Het
Gm17333	AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA	AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA	16: 77,852,878		noncoding transcript	Het
Gnb1	C	A	4: 155,543,074	A104E	probably damaging	Het
Gnptg	ATTGTTGATGATTT	AT	17: 25,235,597		probably benign	Het
Htra4	A	T	8: 25,033,697	V284E	probably damaging	Het
Igkv3-3	A	T	6: 70,687,324	D50V	probably benign	Het
Irs3	A	G	5: 137,643,947	S410P	probably benign	Het
Kif26b	C	T	1: 178,873,981	Q642*	probably null	Het
Klhl11	A	T	11: 100,464,350	M215K	probably benign	Het
Lamc3	A	G	2: 31,905,614	N337S	possibly damaging	Het
Lrrc55	G	A	2: 85,196,170	A170V	probably damaging	Het
March3	A	T	18: 56,776,072	W214R	probably damaging	Het
Megf11	A	C	9: 64,508,745	T79P	probably damaging	Het
Mia3	A	G	1: 183,345,220	V26A	possibly damaging	Het
Myrf	A	G	19: 10,218,591	F353S	probably damaging	Het
Obscn	A	G	11: 59,079,808		probably null	Het
Ocstamp	T	C	2: 165,396,288	K352R	probably benign	Het
Olfr721-ps1	A	T	14: 14,407,359	I46F	probably benign	Het
Olfr874	G	T	9: 37,746,157	V8L	probably benign	Het
Osbpl3	T	C	6: 50,328,674	N434S	probably damaging	Het
Pign	A	C	1: 105,585,024	L645V	probably benign	Het
Ppp2r3c	A	T	12: 55,302,635		probably null	Het
Ptprf	A	G	4: 118,225,039	V414A	possibly damaging	Het
Pyroxd2	G	A	19: 42,752,400	R22*	probably null	Het
Rab11fip2	G	A	19: 59,937,110	A225V	probably damaging	Het
Ranbp2	C	T	10: 58,492,670	A2836V	probably damaging	Het
Rimklb	G	A	6: 122,472,632	R28*	probably null	Het
Scyl3	G	A	1: 163,949,251	R404Q	probably damaging	Het
Slc9a8	A	T	2: 167,441,170	K79*	probably null	Het
Sowaha	A	T	11: 53,479,336		probably null	Het
Tnk1	A	G	11: 69,855,166	V311A	probably damaging	Het
Tnrc6a	T	A	7: 123,189,997	S1680T	probably damaging	Het
Tpp1	T	C	7: 105,748,951	Y335C	probably damaging	Het
Ttc39b	A	G	4: 83,244,103	V308A	probably benign	Het
Ttll3	A	C	6: 113,407,392	Q557P	probably damaging	Het
Ulk3	G	A	9: 57,592,918	A266T	probably benign	Het
Wfdc6b	C	A	2: 164,617,433	C138*	probably null	Het
Znrd1as	A	T	17: 36,964,873	I116L	probably benign	Het

Other mutations in Polr2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00987:Polr2a	APN	11	69743794	splice site	probably benign
IGL01067:Polr2a	APN	11	69748014	missense	possibly damaging	0.94
IGL01547:Polr2a	APN	11	69744942	missense	probably damaging	0.99
IGL01589:Polr2a	APN	11	69741194	missense	probably benign
IGL01955:Polr2a	APN	11	69741848	missense	probably damaging	1.00
IGL02457:Polr2a	APN	11	69743250	splice site	probably benign
IGL02526:Polr2a	APN	11	69739467	missense	probably benign	0.03
IGL02792:Polr2a	APN	11	69746112	missense	probably damaging	0.99
IGL03058:Polr2a	APN	11	69745047	splice site	probably null
IGL03083:Polr2a	APN	11	69745046	critical splice acceptor site	probably null
IGL03198:Polr2a	APN	11	69747281	splice site	probably null
IGL03201:Polr2a	APN	11	69745690	nonsense	probably null
Leastest	UTSW	11	69747292	splice site	probably null
PIT4260001:Polr2a	UTSW	11	69735967	missense	possibly damaging	0.93
R0126:Polr2a	UTSW	11	69747425	missense	probably damaging	0.99
R0254:Polr2a	UTSW	11	69743671	missense	possibly damaging	0.75
R0313:Polr2a	UTSW	11	69735080	missense	unknown
R0336:Polr2a	UTSW	11	69736893	missense	possibly damaging	0.92
R0453:Polr2a	UTSW	11	69741019	missense	possibly damaging	0.65
R0762:Polr2a	UTSW	11	69735117	missense	unknown
R1101:Polr2a	UTSW	11	69748071	missense	probably benign	0.23
R1509:Polr2a	UTSW	11	69747213	missense	possibly damaging	0.93
R1547:Polr2a	UTSW	11	69734555	missense	probably benign	0.39
R1567:Polr2a	UTSW	11	69746031	missense	probably benign	0.07
R1597:Polr2a	UTSW	11	69739929	missense	possibly damaging	0.88
R1614:Polr2a	UTSW	11	69743373	missense	possibly damaging	0.75
R1698:Polr2a	UTSW	11	69739877	critical splice donor site	probably null
R1735:Polr2a	UTSW	11	69742396	missense	probably damaging	0.99
R1743:Polr2a	UTSW	11	69739503	missense	probably damaging	0.96
R1899:Polr2a	UTSW	11	69743946	missense	probably damaging	0.99
R1900:Polr2a	UTSW	11	69743946	missense	probably damaging	0.99
R1931:Polr2a	UTSW	11	69735375	missense	unknown
R2217:Polr2a	UTSW	11	69742685	critical splice donor site	probably null
R2218:Polr2a	UTSW	11	69742685	critical splice donor site	probably null
R2245:Polr2a	UTSW	11	69735183	missense	unknown
R3123:Polr2a	UTSW	11	69735710	missense	possibly damaging	0.92
R3124:Polr2a	UTSW	11	69735710	missense	possibly damaging	0.92
R4018:Polr2a	UTSW	11	69735059	missense	unknown
R4025:Polr2a	UTSW	11	69743659	missense	possibly damaging	0.95
R4197:Polr2a	UTSW	11	69735336	missense	unknown
R4462:Polr2a	UTSW	11	69746403	missense	probably damaging	1.00
R4508:Polr2a	UTSW	11	69742559	critical splice acceptor site	probably null
R5069:Polr2a	UTSW	11	69736735	splice site	probably null
R5102:Polr2a	UTSW	11	69746945	missense	possibly damaging	0.93
R5195:Polr2a	UTSW	11	69744079	missense	probably damaging	1.00
R5234:Polr2a	UTSW	11	69736840	missense	probably benign	0.03
R5330:Polr2a	UTSW	11	69747275	missense	probably benign	0.01
R5331:Polr2a	UTSW	11	69747275	missense	probably benign	0.01
R5896:Polr2a	UTSW	11	69736260	missense	probably damaging	0.99
R5910:Polr2a	UTSW	11	69746870	missense	probably damaging	0.99
R6128:Polr2a	UTSW	11	69736977	missense	probably damaging	1.00
R6238:Polr2a	UTSW	11	69747221	missense	possibly damaging	0.95
R6244:Polr2a	UTSW	11	69744226	missense	probably damaging	1.00
R6303:Polr2a	UTSW	11	69746913	missense	probably damaging	1.00
R6338:Polr2a	UTSW	11	69739679	splice site	probably null
R6361:Polr2a	UTSW	11	69743337	missense	probably damaging	0.99
R6374:Polr2a	UTSW	11	69736932	missense	probably damaging	0.98
R6630:Polr2a	UTSW	11	69735513	missense	possibly damaging	0.93
R6631:Polr2a	UTSW	11	69735513	missense	possibly damaging	0.93
R6633:Polr2a	UTSW	11	69735513	missense	possibly damaging	0.93
R6897:Polr2a	UTSW	11	69735961	missense	probably benign	0.12
R6923:Polr2a	UTSW	11	69735961	missense	probably benign	0.12
R6933:Polr2a	UTSW	11	69736177	missense	probably damaging	0.99
R6933:Polr2a	UTSW	11	69739467	missense	probably benign	0.03
R6953:Polr2a	UTSW	11	69741711	missense	probably damaging	0.99
R6974:Polr2a	UTSW	11	69747200	missense	probably damaging	0.98
R7033:Polr2a	UTSW	11	69747213	missense	possibly damaging	0.93
R7085:Polr2a	UTSW	11	69743880	missense	probably damaging	0.99
R7112:Polr2a	UTSW	11	69735309	missense	unknown
R7124:Polr2a	UTSW	11	69737462	nonsense	probably null
R7307:Polr2a	UTSW	11	69747292	splice site	probably null
R7319:Polr2a	UTSW	11	69746370	missense	possibly damaging	0.95
R7350:Polr2a	UTSW	11	69741060	missense	possibly damaging	0.92
R7369:Polr2a	UTSW	11	69745977	missense	probably benign	0.01
R7585:Polr2a	UTSW	11	69740002	missense	probably damaging	0.99
R7882:Polr2a	UTSW	11	69736174	missense	possibly damaging	0.86
R7935:Polr2a	UTSW	11	69747504	missense	probably benign	0.00
R8080:Polr2a	UTSW	11	69735048	missense	unknown
R8140:Polr2a	UTSW	11	69746376	missense	probably benign	0.12
R8221:Polr2a	UTSW	11	69737518	missense	probably benign	0.24
R8245:Polr2a	UTSW	11	69739953	missense	probably damaging	0.99
R8274:Polr2a	UTSW	11	69748056	missense	probably damaging	0.99
R8275:Polr2a	UTSW	11	69748056	missense	probably damaging	0.99
R8276:Polr2a	UTSW	11	69748056	missense	probably damaging	0.99
R8277:Polr2a	UTSW	11	69748056	missense	probably damaging	0.99
R8311:Polr2a	UTSW	11	69737456	missense	probably null	0.20

Predicted Primers

PCR Primer
(F):5'- GGGCTCTGGGGTGTATAGCC -3'
(R):5'- TCCAGGAAGAGAAGCGTCGG -3'

Sequencing Primer
(F):5'- GGGTGTATAGCCCCCAGG -3'
(R):5'- AGAAGCGTCGGACTTCGTG -3'

Posted On

2015-11-11