Incidental Mutation 'R4746:Gnptg'
ID356757
Institutional Source Beutler Lab
Gene Symbol Gnptg
Ensembl Gene ENSMUSG00000035521
Gene NameN-acetylglucosamine-1-phosphotransferase, gamma subunit
Synonyms
MMRRC Submission 041968-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R4746 (G1)
Quality Score217
Status Not validated
Chromosome17
Chromosomal Location25233331-25240124 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) ATTGTTGATGATTT to AT at 25235597 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015271] [ENSMUST00000038973] [ENSMUST00000039734] [ENSMUST00000063574] [ENSMUST00000115154] [ENSMUST00000160896] [ENSMUST00000161679]
Predicted Effect probably benign
Transcript: ENSMUST00000015271
SMART Domains Protein: ENSMUSP00000015271
Gene: ENSMUSG00000015127

DomainStartEndE-ValueType
coiled coil region 73 154 N/A INTRINSIC
RING 198 232 4.13e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000038973
SMART Domains Protein: ENSMUSP00000042073
Gene: ENSMUSG00000035521

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:PRKCSH 69 152 1.4e-10 PFAM
DMAP_binding 176 278 2.55e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000039734
SMART Domains Protein: ENSMUSP00000039670
Gene: ENSMUSG00000015127

DomainStartEndE-ValueType
low complexity region 61 69 N/A INTRINSIC
ZnF_C3H1 76 103 1.33e-1 SMART
Blast:ZnF_C3H1 115 144 7e-13 BLAST
ZnF_C3H1 207 232 2.49e1 SMART
ZnF_C3H1 243 276 9.28e-1 SMART
ZnF_C3H1 285 312 8.47e-4 SMART
low complexity region 371 412 N/A INTRINSIC
low complexity region 463 495 N/A INTRINSIC
low complexity region 499 505 N/A INTRINSIC
low complexity region 511 527 N/A INTRINSIC
coiled coil region 561 642 N/A INTRINSIC
RING 686 720 4.13e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000063574
SMART Domains Protein: ENSMUSP00000068511
Gene: ENSMUSG00000015126

DomainStartEndE-ValueType
Pfam:RLI 58 92 8.2e-17 PFAM
Pfam:DUF367 96 222 1.3e-56 PFAM
low complexity region 261 282 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115154
SMART Domains Protein: ENSMUSP00000110807
Gene: ENSMUSG00000035521

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:PRKCSH 69 151 3.9e-11 PFAM
DMAP_binding 183 285 2.55e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160896
SMART Domains Protein: ENSMUSP00000124276
Gene: ENSMUSG00000015127

DomainStartEndE-ValueType
ZnF_C3H1 21 46 2.49e1 SMART
ZnF_C3H1 57 90 9.28e-1 SMART
ZnF_C3H1 99 126 8.47e-4 SMART
low complexity region 185 226 N/A INTRINSIC
low complexity region 277 309 N/A INTRINSIC
low complexity region 313 319 N/A INTRINSIC
low complexity region 325 341 N/A INTRINSIC
coiled coil region 375 456 N/A INTRINSIC
RING 500 534 4.13e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161679
SMART Domains Protein: ENSMUSP00000125294
Gene: ENSMUSG00000015127

DomainStartEndE-ValueType
low complexity region 3 9 N/A INTRINSIC
low complexity region 15 31 N/A INTRINSIC
coiled coil region 65 146 N/A INTRINSIC
RING 190 224 4.13e-2 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the gamma sunbunit of the N-acetylglucosamine-1-phosphotransferase complex. This hexameric complex, composed of alpha, beta and gamma subunits, catalyzes the first step in synthesis of a mannose 6-phosphate lysosomal recognition marker. This enzyme complex is necessary for targeting of lysosomal hydrolases to the lysosome. Mutations in the gene encoding the gamma subunit have been associated with mucolipidosis IIIC, also known as mucolipidosis III gamma.[provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a knock-out allele show a partial loss of lysosomal enzyme phosphorylation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik G A 2: 152,440,765 S180N probably benign Het
Atp5a1 G T 18: 77,778,742 G165V probably benign Het
Cbfa2t2 A C 2: 154,523,925 M352L possibly damaging Het
Ccser2 A T 14: 36,909,125 D98E probably damaging Het
Cfap20 A G 8: 95,422,056 probably null Het
Chuk A T 19: 44,088,771 C379S possibly damaging Het
Cic G A 7: 25,288,480 G1531E probably damaging Het
Ckap4 A G 10: 84,533,520 V116A possibly damaging Het
Cxcl13 A G 5: 95,959,897 K71E probably damaging Het
Dmxl2 A T 9: 54,451,796 I210N probably benign Het
Donson A C 16: 91,682,237 V397G probably damaging Het
Dpy19l1 C A 9: 24,450,670 V332L probably benign Het
Dsp T C 13: 38,195,104 S1343P possibly damaging Het
Egflam A G 15: 7,224,639 probably null Het
Eif2b4 A G 5: 31,187,653 I550T probably damaging Het
Fbxo47 A T 11: 97,879,428 V46D probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Folr1 T A 7: 101,863,977 D37V probably damaging Het
Gm17333 AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA 16: 77,852,878 noncoding transcript Het
Gnb1 C A 4: 155,543,074 A104E probably damaging Het
Htra4 A T 8: 25,033,697 V284E probably damaging Het
Igkv3-3 A T 6: 70,687,324 D50V probably benign Het
Irs3 A G 5: 137,643,947 S410P probably benign Het
Kif26b C T 1: 178,873,981 Q642* probably null Het
Klhl11 A T 11: 100,464,350 M215K probably benign Het
Lamc3 A G 2: 31,905,614 N337S possibly damaging Het
Lrrc55 G A 2: 85,196,170 A170V probably damaging Het
March3 A T 18: 56,776,072 W214R probably damaging Het
Megf11 A C 9: 64,508,745 T79P probably damaging Het
Mia3 A G 1: 183,345,220 V26A possibly damaging Het
Myrf A G 19: 10,218,591 F353S probably damaging Het
Obscn A G 11: 59,079,808 probably null Het
Ocstamp T C 2: 165,396,288 K352R probably benign Het
Olfr721-ps1 A T 14: 14,407,359 I46F probably benign Het
Olfr874 G T 9: 37,746,157 V8L probably benign Het
Osbpl3 T C 6: 50,328,674 N434S probably damaging Het
Pign A C 1: 105,585,024 L645V probably benign Het
Polr2a A G 11: 69,735,674 S1540P probably benign Het
Ppp2r3c A T 12: 55,302,635 probably null Het
Ptprf A G 4: 118,225,039 V414A possibly damaging Het
Pyroxd2 G A 19: 42,752,400 R22* probably null Het
Rab11fip2 G A 19: 59,937,110 A225V probably damaging Het
Ranbp2 C T 10: 58,492,670 A2836V probably damaging Het
Rimklb G A 6: 122,472,632 R28* probably null Het
Scyl3 G A 1: 163,949,251 R404Q probably damaging Het
Slc9a8 A T 2: 167,441,170 K79* probably null Het
Sowaha A T 11: 53,479,336 probably null Het
Tnk1 A G 11: 69,855,166 V311A probably damaging Het
Tnrc6a T A 7: 123,189,997 S1680T probably damaging Het
Tpp1 T C 7: 105,748,951 Y335C probably damaging Het
Ttc39b A G 4: 83,244,103 V308A probably benign Het
Ttll3 A C 6: 113,407,392 Q557P probably damaging Het
Ulk3 G A 9: 57,592,918 A266T probably benign Het
Wfdc6b C A 2: 164,617,433 C138* probably null Het
Znrd1as A T 17: 36,964,873 I116L probably benign Het
Other mutations in Gnptg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02533:Gnptg APN 17 25235455 missense possibly damaging 0.92
R1499:Gnptg UTSW 17 25235854 critical splice donor site probably null
R5841:Gnptg UTSW 17 25235417 missense probably damaging 1.00
R6614:Gnptg UTSW 17 25235261 missense probably damaging 1.00
R7082:Gnptg UTSW 17 25234720 missense probably benign 0.04
R7236:Gnptg UTSW 17 25239923 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- GCATAGACACAGGTGCTTGG -3'
(R):5'- CCTGTGTTCCCAGGTACAAG -3'

Sequencing Primer
(F):5'- TAGACACAGGTGCTTGGCTCAG -3'
(R):5'- TCCCAGGTACAAGTATGAATTCTGCC -3'
Posted On2015-11-11