Incidental Mutation 'R4746:Myrf'
ID356762
Institutional Source Beutler Lab
Gene Symbol Myrf
Ensembl Gene ENSMUSG00000036098
Gene Namemyelin regulatory factor
SynonymsGm98, LOC386531, LOC225908
MMRRC Submission 041968-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.742) question?
Stock #R4746 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location10208272-10240748 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10218591 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 353 (F353S)
Ref Sequence ENSEMBL: ENSMUSP00000140871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088013] [ENSMUST00000186056] [ENSMUST00000189897]
Predicted Effect probably damaging
Transcript: ENSMUST00000088013
AA Change: F555S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000085329
Gene: ENSMUSG00000036098
AA Change: F555S

DomainStartEndE-ValueType
low complexity region 67 99 N/A INTRINSIC
low complexity region 177 199 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
low complexity region 285 306 N/A INTRINSIC
low complexity region 320 346 N/A INTRINSIC
Pfam:NDT80_PhoG 393 540 7.6e-31 PFAM
Pfam:Peptidase_S74 587 647 5.3e-16 PFAM
Pfam:MRF_C1 667 702 8.3e-26 PFAM
low complexity region 773 784 N/A INTRINSIC
low complexity region 847 884 N/A INTRINSIC
Pfam:MRF_C2 977 1111 1.4e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000186056
AA Change: F353S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140871
Gene: ENSMUSG00000036098
AA Change: F353S

DomainStartEndE-ValueType
low complexity region 83 104 N/A INTRINSIC
low complexity region 118 144 N/A INTRINSIC
Pfam:NDT80_PhoG 191 338 6.9e-28 PFAM
Pfam:Peptidase_S74 385 445 1.2e-12 PFAM
Pfam:MRF_C1 465 500 1.4e-23 PFAM
low complexity region 571 582 N/A INTRINSIC
low complexity region 672 709 N/A INTRINSIC
Pfam:MRF_C2 801 936 7e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186854
Predicted Effect probably damaging
Transcript: ENSMUST00000189897
AA Change: F555S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139601
Gene: ENSMUSG00000036098
AA Change: F555S

DomainStartEndE-ValueType
low complexity region 67 99 N/A INTRINSIC
low complexity region 177 199 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
low complexity region 285 306 N/A INTRINSIC
low complexity region 320 346 N/A INTRINSIC
Pfam:NDT80_PhoG 393 540 7.6e-31 PFAM
Pfam:Peptidase_S74 587 647 1.1e-15 PFAM
Pfam:MRF_C1 667 702 1.1e-26 PFAM
low complexity region 773 784 N/A INTRINSIC
low complexity region 847 884 N/A INTRINSIC
Pfam:MRF_C2 976 1111 5.5e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190922
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that is required for central nervous system myelination and may regulate oligodendrocyte differentiation. It is thought to act by increasing the expression of genes that effect myelin production but may also directly promote myelin gene expression. Loss of a similar gene in mouse models results in severe demyelination. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik G A 2: 152,440,765 S180N probably benign Het
Atp5a1 G T 18: 77,778,742 G165V probably benign Het
Cbfa2t2 A C 2: 154,523,925 M352L possibly damaging Het
Ccser2 A T 14: 36,909,125 D98E probably damaging Het
Cfap20 A G 8: 95,422,056 probably null Het
Chuk A T 19: 44,088,771 C379S possibly damaging Het
Cic G A 7: 25,288,480 G1531E probably damaging Het
Ckap4 A G 10: 84,533,520 V116A possibly damaging Het
Cxcl13 A G 5: 95,959,897 K71E probably damaging Het
Dmxl2 A T 9: 54,451,796 I210N probably benign Het
Donson A C 16: 91,682,237 V397G probably damaging Het
Dpy19l1 C A 9: 24,450,670 V332L probably benign Het
Dsp T C 13: 38,195,104 S1343P possibly damaging Het
Egflam A G 15: 7,224,639 probably null Het
Eif2b4 A G 5: 31,187,653 I550T probably damaging Het
Fbxo47 A T 11: 97,879,428 V46D probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Folr1 T A 7: 101,863,977 D37V probably damaging Het
Gm17333 AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA 16: 77,852,878 noncoding transcript Het
Gnb1 C A 4: 155,543,074 A104E probably damaging Het
Gnptg ATTGTTGATGATTT AT 17: 25,235,597 probably benign Het
Htra4 A T 8: 25,033,697 V284E probably damaging Het
Igkv3-3 A T 6: 70,687,324 D50V probably benign Het
Irs3 A G 5: 137,643,947 S410P probably benign Het
Kif26b C T 1: 178,873,981 Q642* probably null Het
Klhl11 A T 11: 100,464,350 M215K probably benign Het
Lamc3 A G 2: 31,905,614 N337S possibly damaging Het
Lrrc55 G A 2: 85,196,170 A170V probably damaging Het
March3 A T 18: 56,776,072 W214R probably damaging Het
Megf11 A C 9: 64,508,745 T79P probably damaging Het
Mia3 A G 1: 183,345,220 V26A possibly damaging Het
Obscn A G 11: 59,079,808 probably null Het
Ocstamp T C 2: 165,396,288 K352R probably benign Het
Olfr721-ps1 A T 14: 14,407,359 I46F probably benign Het
Olfr874 G T 9: 37,746,157 V8L probably benign Het
Osbpl3 T C 6: 50,328,674 N434S probably damaging Het
Pign A C 1: 105,585,024 L645V probably benign Het
Polr2a A G 11: 69,735,674 S1540P probably benign Het
Ppp2r3c A T 12: 55,302,635 probably null Het
Ptprf A G 4: 118,225,039 V414A possibly damaging Het
Pyroxd2 G A 19: 42,752,400 R22* probably null Het
Rab11fip2 G A 19: 59,937,110 A225V probably damaging Het
Ranbp2 C T 10: 58,492,670 A2836V probably damaging Het
Rimklb G A 6: 122,472,632 R28* probably null Het
Scyl3 G A 1: 163,949,251 R404Q probably damaging Het
Slc9a8 A T 2: 167,441,170 K79* probably null Het
Sowaha A T 11: 53,479,336 probably null Het
Tnk1 A G 11: 69,855,166 V311A probably damaging Het
Tnrc6a T A 7: 123,189,997 S1680T probably damaging Het
Tpp1 T C 7: 105,748,951 Y335C probably damaging Het
Ttc39b A G 4: 83,244,103 V308A probably benign Het
Ttll3 A C 6: 113,407,392 Q557P probably damaging Het
Ulk3 G A 9: 57,592,918 A266T probably benign Het
Wfdc6b C A 2: 164,617,433 C138* probably null Het
Znrd1as A T 17: 36,964,873 I116L probably benign Het
Other mutations in Myrf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Myrf APN 19 10224513 missense probably benign 0.30
IGL01132:Myrf APN 19 10223205 missense probably damaging 1.00
IGL01958:Myrf APN 19 10210378 unclassified probably benign
IGL02154:Myrf APN 19 10216118 missense probably damaging 0.98
IGL02370:Myrf APN 19 10214140 missense probably benign
IGL02584:Myrf APN 19 10212223 splice site probably benign
IGL02817:Myrf APN 19 10225452 missense probably benign 0.45
R0312:Myrf UTSW 19 10218162 missense probably benign 0.00
R0367:Myrf UTSW 19 10218162 missense probably benign 0.00
R0389:Myrf UTSW 19 10218162 missense probably benign 0.00
R0416:Myrf UTSW 19 10215812 critical splice acceptor site probably null
R0446:Myrf UTSW 19 10218162 missense probably benign 0.00
R0464:Myrf UTSW 19 10218162 missense probably benign 0.00
R0465:Myrf UTSW 19 10218162 missense probably benign 0.00
R0487:Myrf UTSW 19 10218162 missense probably benign 0.00
R0533:Myrf UTSW 19 10218162 missense probably benign 0.00
R0534:Myrf UTSW 19 10218162 missense probably benign 0.00
R0570:Myrf UTSW 19 10211797 missense probably damaging 1.00
R0622:Myrf UTSW 19 10223452 missense probably damaging 0.99
R0631:Myrf UTSW 19 10228882 missense probably benign 0.00
R0721:Myrf UTSW 19 10216080 missense probably damaging 1.00
R0848:Myrf UTSW 19 10218162 missense probably benign 0.00
R1056:Myrf UTSW 19 10223486 missense probably benign 0.11
R1574:Myrf UTSW 19 10225487 missense probably damaging 1.00
R1574:Myrf UTSW 19 10225487 missense probably damaging 1.00
R1801:Myrf UTSW 19 10214191 missense probably benign 0.03
R1897:Myrf UTSW 19 10218232 missense probably benign 0.05
R1950:Myrf UTSW 19 10218190 missense possibly damaging 0.93
R1957:Myrf UTSW 19 10219796 missense probably benign 0.04
R2089:Myrf UTSW 19 10224600 missense possibly damaging 0.48
R2091:Myrf UTSW 19 10224600 missense possibly damaging 0.48
R2091:Myrf UTSW 19 10224600 missense possibly damaging 0.48
R2139:Myrf UTSW 19 10216467 missense probably damaging 0.98
R2144:Myrf UTSW 19 10228674 missense probably benign 0.05
R3932:Myrf UTSW 19 10218151 missense probably damaging 1.00
R3964:Myrf UTSW 19 10219615 missense probably benign 0.03
R3966:Myrf UTSW 19 10219615 missense probably benign 0.03
R3970:Myrf UTSW 19 10223237 missense probably damaging 1.00
R4607:Myrf UTSW 19 10229067 missense probably damaging 1.00
R5117:Myrf UTSW 19 10212493 missense probably damaging 1.00
R5598:Myrf UTSW 19 10215290 missense probably benign 0.00
R5719:Myrf UTSW 19 10216723 missense probably damaging 1.00
R5841:Myrf UTSW 19 10223547 missense probably null 1.00
R5994:Myrf UTSW 19 10219117 missense probably null 1.00
R6148:Myrf UTSW 19 10212475 missense probably damaging 0.99
R6229:Myrf UTSW 19 10219798 missense probably benign 0.19
R6477:Myrf UTSW 19 10228785 missense probably benign 0.41
R6623:Myrf UTSW 19 10223359 missense probably benign 0.13
R6878:Myrf UTSW 19 10216478 missense possibly damaging 0.80
R6932:Myrf UTSW 19 10219560 missense probably damaging 1.00
R7127:Myrf UTSW 19 10215341 missense probably benign 0.01
R7162:Myrf UTSW 19 10218646 missense possibly damaging 0.75
R7553:Myrf UTSW 19 10228876 missense probably benign
R7585:Myrf UTSW 19 10216727 missense probably damaging 1.00
R7838:Myrf UTSW 19 10219619 missense possibly damaging 0.55
R7921:Myrf UTSW 19 10219619 missense possibly damaging 0.55
X0028:Myrf UTSW 19 10212158 missense probably damaging 1.00
Z1088:Myrf UTSW 19 10221298 missense probably damaging 1.00
Z1177:Myrf UTSW 19 10219544 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCAATCACTCAAGGCAGG -3'
(R):5'- TTGACTGGCCTAGGTGTTCC -3'

Sequencing Primer
(F):5'- AGGGGTCCTACTCATCACC -3'
(R):5'- CTAGGTGTTCCTGGGGTTTCC -3'
Posted On2015-11-11