Incidental Mutation 'R4760:Fmo4'
ID 356772
Institutional Source Beutler Lab
Gene Symbol Fmo4
Ensembl Gene ENSMUSG00000026692
Gene Name flavin containing monooxygenase 4
Synonyms
MMRRC Submission 041974-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.093) question?
Stock # R4760 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 162620757-162641541 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 162637396 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 32 (E32V)
Ref Sequence ENSEMBL: ENSMUSP00000118476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028014] [ENSMUST00000111525] [ENSMUST00000140274] [ENSMUST00000144916]
AlphaFold Q8VHG0
Predicted Effect probably damaging
Transcript: ENSMUST00000028014
AA Change: E32V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028014
Gene: ENSMUSG00000026692
AA Change: E32V

DomainStartEndE-ValueType
Pfam:FMO-like 2 531 9.4e-272 PFAM
Pfam:Pyr_redox_2 4 430 1e-8 PFAM
Pfam:Pyr_redox_3 6 220 5.1e-16 PFAM
Pfam:K_oxygenase 68 227 1.7e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111525
AA Change: E32V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107150
Gene: ENSMUSG00000026692
AA Change: E32V

DomainStartEndE-ValueType
Pfam:FMO-like 2 531 9.4e-272 PFAM
Pfam:Pyr_redox_2 3 225 1.7e-11 PFAM
Pfam:Pyr_redox_3 6 220 2.5e-9 PFAM
Pfam:K_oxygenase 67 227 6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140031
Predicted Effect probably damaging
Transcript: ENSMUST00000140274
AA Change: E32V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118476
Gene: ENSMUSG00000026692
AA Change: E32V

DomainStartEndE-ValueType
Pfam:FMO-like 2 99 1.5e-57 PFAM
Pfam:NAD_binding_8 7 94 1.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144916
SMART Domains Protein: ENSMUSP00000119389
Gene: ENSMUSG00000026692

DomainStartEndE-ValueType
Pfam:FMO-like 1 114 2.6e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193508
Meta Mutation Damage Score 0.9546 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Metabolic N-oxidation of diet-derived amino-trimethylamine (TMA) is mediated by flavin-containing monooxygenase and is subject to an inherited FMO3 polymorphism in man. This results in a small subpopulation with reduced TMA N-oxidation capacity and causes fish odor syndrome (Trimethylaminuria). Three forms of the enzyme are encoded by genes clustered in the 1q23-q25 region. Flavin-containing monooxygenases are NADPH-dependent flavoenzymes that catalyzes the oxidation of soft nucleophilic heteroatom centers in drugs, pesticides, and xenobiotics. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530053G22Rik A G 6: 60,379,086 (GRCm39) noncoding transcript Het
Abcc2 A T 19: 43,798,920 (GRCm39) Y512F probably benign Het
Adgrb1 T A 15: 74,443,312 (GRCm39) I51N probably damaging Het
Adhfe1 A G 1: 9,633,748 (GRCm39) Y332C probably damaging Het
Ambn C T 5: 88,615,566 (GRCm39) L317F probably damaging Het
Amn1 T C 6: 149,086,611 (GRCm39) Y17C probably benign Het
Apoa5 T C 9: 46,181,593 (GRCm39) V223A probably damaging Het
Best3 A T 10: 116,860,699 (GRCm39) H653L probably benign Het
Btnl2 C A 17: 34,582,169 (GRCm39) S245Y probably damaging Het
Camk1d A G 2: 5,366,867 (GRCm39) L116P probably damaging Het
Catsperg2 T A 7: 29,405,060 (GRCm39) D698V probably damaging Het
Cd33 T C 7: 43,178,919 (GRCm39) T307A probably benign Het
Cdk8 C T 5: 146,229,476 (GRCm39) S230L probably benign Het
Cfap69 C T 5: 5,696,939 (GRCm39) C119Y probably damaging Het
Chat T C 14: 32,175,694 (GRCm39) N122S probably benign Het
Col20a1 A T 2: 180,626,196 (GRCm39) probably benign Het
Cyp2j9 A T 4: 96,457,028 (GRCm39) L481Q probably damaging Het
Dab1 A C 4: 104,589,342 (GRCm39) S550R probably damaging Het
Dlgap2 A C 8: 14,823,380 (GRCm39) Q533P probably damaging Het
Eif4g3 A T 4: 137,811,629 (GRCm39) Q31L possibly damaging Het
Ets2 G A 16: 95,520,087 (GRCm39) V438M probably damaging Het
Eva1c G A 16: 90,701,138 (GRCm39) D258N probably benign Het
Fastkd2 A G 1: 63,785,045 (GRCm39) H477R probably benign Het
Fga T G 3: 82,938,821 (GRCm39) S399A probably benign Het
Gm7204 T A 16: 48,039,051 (GRCm39) noncoding transcript Het
Gpi-ps G A 8: 5,690,473 (GRCm39) noncoding transcript Het
Hhipl1 A G 12: 108,286,336 (GRCm39) I548V probably damaging Het
Hsfy2 T C 1: 56,676,349 (GRCm39) T63A probably benign Het
Igf2r A G 17: 12,922,352 (GRCm39) V1254A possibly damaging Het
Ighv8-4 A T 12: 114,987,667 (GRCm39) D110E probably damaging Het
Igkv14-130 T C 6: 67,768,446 (GRCm39) S101P probably benign Het
Igkv9-120 G T 6: 68,027,351 (GRCm39) R88S possibly damaging Het
Ipo5 T C 14: 121,179,054 (GRCm39) V779A probably benign Het
Itpr1 C T 6: 108,326,593 (GRCm39) T105I probably benign Het
Kalrn T C 16: 34,018,857 (GRCm39) M670V probably damaging Het
Kdm8 T A 7: 125,054,431 (GRCm39) probably null Het
Kics2 T C 10: 121,575,912 (GRCm39) V11A probably damaging Het
L3hypdh T C 12: 72,124,016 (GRCm39) I281V probably benign Het
Lins1 T G 7: 66,364,435 (GRCm39) probably benign Het
Map4k5 T A 12: 69,871,372 (GRCm39) I517L possibly damaging Het
Marchf2 G T 17: 33,928,890 (GRCm39) T2K probably damaging Het
Mlkl C G 8: 112,046,348 (GRCm39) probably null Het
Mllt1 A G 17: 57,209,630 (GRCm39) M160T probably benign Het
Mmp15 G A 8: 96,094,824 (GRCm39) A233T possibly damaging Het
Moxd2 C A 6: 40,868,537 (GRCm39) T23N probably benign Het
Nop53 C A 7: 15,676,812 (GRCm39) K100N probably benign Het
Nrg1 C A 8: 32,408,228 (GRCm39) E2* probably null Het
Or52u1 T A 7: 104,237,696 (GRCm39) H228Q probably benign Het
Pank4 A G 4: 155,059,091 (GRCm39) D408G possibly damaging Het
Pcdhb10 T C 18: 37,544,995 (GRCm39) W24R probably benign Het
Pcm1 C T 8: 41,740,775 (GRCm39) T968I probably damaging Het
Pkib G T 10: 57,584,246 (GRCm39) M19I probably benign Het
Ppy A G 11: 101,991,345 (GRCm39) probably null Het
Pramel21 G A 4: 143,343,801 (GRCm39) R367K probably benign Het
Prdx3 A C 19: 60,861,621 (GRCm39) C39W possibly damaging Het
Qrfpr T G 3: 36,276,073 (GRCm39) N106H probably benign Het
Rai14 G A 15: 10,575,776 (GRCm39) T394M possibly damaging Het
Ralgapa2 A T 2: 146,188,669 (GRCm39) L1371Q probably benign Het
Rbm12 A G 2: 155,939,048 (GRCm39) L408P probably damaging Het
Rdx T C 9: 51,977,174 (GRCm39) I141T probably benign Het
Reep1 T A 6: 71,684,985 (GRCm39) V11E possibly damaging Het
Relch T A 1: 105,649,030 (GRCm39) M723K probably benign Het
Sall4 A G 2: 168,592,347 (GRCm39) S936P probably damaging Het
Serac1 A G 17: 6,102,065 (GRCm39) M403T possibly damaging Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Slc35g2 T G 9: 100,435,549 (GRCm39) I41L probably benign Het
Slc39a12 G A 2: 14,405,134 (GRCm39) S242N probably benign Het
Slc9a2 T A 1: 40,801,076 (GRCm39) D535E probably damaging Het
Spata31d1a G T 13: 59,849,459 (GRCm39) P890T probably damaging Het
Sync A G 4: 129,187,232 (GRCm39) Q88R probably benign Het
Tdrp A G 8: 14,024,527 (GRCm39) probably benign Het
Tg G T 15: 66,565,168 (GRCm39) C1170F probably damaging Het
Tnks A T 8: 35,318,937 (GRCm39) D781E probably benign Het
Tnp2 T A 16: 10,606,207 (GRCm39) T87S possibly damaging Het
Tpp2 T C 1: 44,010,875 (GRCm39) V554A probably benign Het
Traf3ip2 T C 10: 39,521,735 (GRCm39) I431T probably damaging Het
Trav9d-4 A T 14: 53,221,258 (GRCm39) H84L probably damaging Het
Vmn2r42 T A 7: 8,187,276 (GRCm39) Y782F probably damaging Het
Vwf T C 6: 125,547,567 (GRCm39) S231P probably damaging Het
Wdr83os A G 8: 85,808,496 (GRCm39) S83G probably damaging Het
Wdr91 T A 6: 34,885,234 (GRCm39) Q109L probably damaging Het
Znrf4 A G 17: 56,818,864 (GRCm39) C148R possibly damaging Het
Other mutations in Fmo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Fmo4 APN 1 162,621,592 (GRCm39) missense probably benign 0.00
IGL01090:Fmo4 APN 1 162,637,354 (GRCm39) splice site probably null
IGL01295:Fmo4 APN 1 162,626,693 (GRCm39) missense probably damaging 1.00
IGL02089:Fmo4 APN 1 162,626,649 (GRCm39) missense probably benign 0.04
IGL02483:Fmo4 APN 1 162,635,990 (GRCm39) missense possibly damaging 0.60
R0608:Fmo4 UTSW 1 162,631,220 (GRCm39) missense possibly damaging 0.95
R0660:Fmo4 UTSW 1 162,637,417 (GRCm39) missense probably benign 0.05
R0737:Fmo4 UTSW 1 162,635,961 (GRCm39) nonsense probably null
R1117:Fmo4 UTSW 1 162,631,232 (GRCm39) missense probably benign 0.03
R1464:Fmo4 UTSW 1 162,621,924 (GRCm39) missense possibly damaging 0.54
R1464:Fmo4 UTSW 1 162,621,924 (GRCm39) missense possibly damaging 0.54
R1577:Fmo4 UTSW 1 162,631,269 (GRCm39) missense possibly damaging 0.50
R1792:Fmo4 UTSW 1 162,621,859 (GRCm39) missense probably benign
R1875:Fmo4 UTSW 1 162,631,187 (GRCm39) missense possibly damaging 0.95
R1929:Fmo4 UTSW 1 162,626,616 (GRCm39) missense possibly damaging 0.95
R1956:Fmo4 UTSW 1 162,631,259 (GRCm39) missense probably benign 0.01
R1957:Fmo4 UTSW 1 162,631,259 (GRCm39) missense probably benign 0.01
R1958:Fmo4 UTSW 1 162,631,259 (GRCm39) missense probably benign 0.01
R2011:Fmo4 UTSW 1 162,626,458 (GRCm39) missense probably damaging 1.00
R2030:Fmo4 UTSW 1 162,621,741 (GRCm39) missense probably damaging 1.00
R2072:Fmo4 UTSW 1 162,637,456 (GRCm39) missense probably benign 0.20
R2272:Fmo4 UTSW 1 162,626,616 (GRCm39) missense possibly damaging 0.95
R3890:Fmo4 UTSW 1 162,621,624 (GRCm39) missense probably benign 0.39
R4255:Fmo4 UTSW 1 162,621,895 (GRCm39) missense probably benign 0.00
R4273:Fmo4 UTSW 1 162,632,748 (GRCm39) missense probably damaging 0.97
R5445:Fmo4 UTSW 1 162,632,842 (GRCm39) missense probably benign 0.24
R5726:Fmo4 UTSW 1 162,635,828 (GRCm39) critical splice donor site probably null
R5786:Fmo4 UTSW 1 162,631,286 (GRCm39) missense probably benign 0.00
R6391:Fmo4 UTSW 1 162,621,538 (GRCm39) nonsense probably null
R6826:Fmo4 UTSW 1 162,631,338 (GRCm39) missense probably damaging 1.00
R7457:Fmo4 UTSW 1 162,621,672 (GRCm39) missense probably benign 0.00
R7913:Fmo4 UTSW 1 162,621,741 (GRCm39) missense possibly damaging 0.69
R8031:Fmo4 UTSW 1 162,626,421 (GRCm39) nonsense probably null
R8055:Fmo4 UTSW 1 162,636,015 (GRCm39) missense probably benign
R8234:Fmo4 UTSW 1 162,632,757 (GRCm39) missense probably damaging 1.00
R8346:Fmo4 UTSW 1 162,621,792 (GRCm39) missense probably benign 0.01
R8706:Fmo4 UTSW 1 162,621,592 (GRCm39) nonsense probably null
R9050:Fmo4 UTSW 1 162,635,099 (GRCm39) missense probably benign 0.15
R9467:Fmo4 UTSW 1 162,631,238 (GRCm39) missense probably benign
R9488:Fmo4 UTSW 1 162,631,337 (GRCm39) missense probably damaging 1.00
R9633:Fmo4 UTSW 1 162,631,191 (GRCm39) missense probably benign 0.00
X0020:Fmo4 UTSW 1 162,621,947 (GRCm39) missense probably benign 0.02
Z1177:Fmo4 UTSW 1 162,631,289 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCTCCTTACATATCAGACCG -3'
(R):5'- AGTAACACTCCCTAGGCTGAGTC -3'

Sequencing Primer
(F):5'- AGTGTTTATCATGGTGCCACAC -3'
(R):5'- CCTAGGCTGAGTCCTATGTCAAG -3'
Posted On 2015-11-11