Mutagenetix > Incidental Mutation

Incidental Mutation 'R4760:Ralgapa2'

356775

Institutional Source

Beutler Lab

Gene Symbol

Ralgapa2

Ensembl Gene

ENSMUSG00000037110

Gene Name

Ral GTPase activating protein, alpha subunit 2 (catalytic)

Synonyms

AS250, RGC2, A230067G21Rik

MMRRC Submission

041974-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.207) question?

Stock #

R4760 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

146239879-146512344 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 146346749 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 1371 (L1371Q)

Ref Sequence

ENSEMBL: ENSMUSP00000153734 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109986] [ENSMUST00000131824] [ENSMUST00000228797]

AlphaFold

A3KGS3

Predicted Effect

probably benign
Transcript: ENSMUST00000109986
AA Change: L1324Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000105613
Gene: ENSMUSG00000037110
AA Change: L1324Q

Domain	Start	End	E-Value	Type
low complexity region	469	480	N/A	INTRINSIC
low complexity region	1017	1028	N/A	INTRINSIC
low complexity region	1296	1301	N/A	INTRINSIC
Pfam:Rap_GAP	1701	1877	6.8e-48	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000131824
AA Change: L1286Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000122039
Gene: ENSMUSG00000037110
AA Change: L1286Q

Domain	Start	End	E-Value	Type
low complexity region	469	480	N/A	INTRINSIC
low complexity region	979	990	N/A	INTRINSIC
low complexity region	1258	1263	N/A	INTRINSIC
Pfam:Rap_GAP	1663	1842	1.3e-66	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000146307
AA Change: L312Q

SMART Domains

Protein: ENSMUSP00000114547
Gene: ENSMUSG00000037110
AA Change: L312Q

Domain	Start	End	E-Value	Type
low complexity region	6	17	N/A	INTRINSIC
low complexity region	285	290	N/A	INTRINSIC
Pfam:Rap_GAP	690	830	4.9e-39	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000149499
AA Change: L956Q

SMART Domains

Protein: ENSMUSP00000122017
Gene: ENSMUSG00000037110
AA Change: L956Q

Domain	Start	End	E-Value	Type
low complexity region	140	151	N/A	INTRINSIC
low complexity region	650	661	N/A	INTRINSIC
low complexity region	929	934	N/A	INTRINSIC
Pfam:Rap_GAP	1334	1511	2.4e-48	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000228797
AA Change: L1371Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 94.4%

Validation Efficiency

98% (90/92)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased incidence and severity of induced urothelial bladder tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	T	A	1: 105,721,305	M723K	probably benign	Het
A530053G22Rik	A	G	6: 60,402,101		noncoding transcript	Het
Abcc2	A	T	19: 43,810,481	Y512F	probably benign	Het
Adgrb1	T	A	15: 74,571,463	I51N	probably damaging	Het
Adhfe1	A	G	1: 9,563,523	Y332C	probably damaging	Het
Ambn	C	T	5: 88,467,707	L317F	probably damaging	Het
Amn1	T	C	6: 149,185,113	Y17C	probably benign	Het
Apoa5	T	C	9: 46,270,295	V223A	probably damaging	Het
BC048403	T	C	10: 121,740,007	V11A	probably damaging	Het
Best3	A	T	10: 117,024,794	H653L	probably benign	Het
Btnl2	C	A	17: 34,363,195	S245Y	probably damaging	Het
Camk1d	A	G	2: 5,362,056	L116P	probably damaging	Het
Catsperg2	T	A	7: 29,705,635	D698V	probably damaging	Het
Cd33	T	C	7: 43,529,495	T307A	probably benign	Het
Cdk8	C	T	5: 146,292,666	S230L	probably benign	Het
Cfap69	C	T	5: 5,646,939	C119Y	probably damaging	Het
Chat	T	C	14: 32,453,737	N122S	probably benign	Het
Col20a1	A	T	2: 180,984,403		probably benign	Het
Cyp2j9	A	T	4: 96,568,791	L481Q	probably damaging	Het
Dab1	A	C	4: 104,732,145	S550R	probably damaging	Het
Dlgap2	A	C	8: 14,773,380	Q533P	probably damaging	Het
Eif4g3	A	T	4: 138,084,318	Q31L	possibly damaging	Het
Ets2	G	A	16: 95,719,043	V438M	probably damaging	Het
Eva1c	G	A	16: 90,904,250	D258N	probably benign	Het
Fastkd2	A	G	1: 63,745,886	H477R	probably benign	Het
Fga	T	G	3: 83,031,514	S399A	probably benign	Het
Fmo4	T	A	1: 162,809,827	E32V	probably damaging	Het
Gm13083	G	A	4: 143,617,231	R367K	probably benign	Het
Gm1840	G	A	8: 5,640,473		noncoding transcript	Het
Gm7204	T	A	16: 48,218,688		noncoding transcript	Het
Hhipl1	A	G	12: 108,320,077	I548V	probably damaging	Het
Hsfy2	T	C	1: 56,637,190	T63A	probably benign	Het
Igf2r	A	G	17: 12,703,465	V1254A	possibly damaging	Het
Ighv8-4	A	T	12: 115,024,047	D110E	probably damaging	Het
Igkv14-130	T	C	6: 67,791,462	S101P	probably benign	Het
Igkv9-120	G	T	6: 68,050,367	R88S	possibly damaging	Het
Ipo5	T	C	14: 120,941,642	V779A	probably benign	Het
Itpr1	C	T	6: 108,349,632	T105I	probably benign	Het
Kalrn	T	C	16: 34,198,487	M670V	probably damaging	Het
Kdm8	T	A	7: 125,455,259		probably null	Het
L3hypdh	T	C	12: 72,077,242	I281V	probably benign	Het
Lins1	T	G	7: 66,714,687		probably benign	Het
Map4k5	T	A	12: 69,824,598	I517L	possibly damaging	Het
March2	G	T	17: 33,709,916	T2K	probably damaging	Het
Mlkl	C	G	8: 111,319,716		probably null	Het
Mllt1	A	G	17: 56,902,630	M160T	probably benign	Het
Mmp15	G	A	8: 95,368,196	A233T	possibly damaging	Het
Moxd2	C	A	6: 40,891,603	T23N	probably benign	Het
Nop53	C	A	7: 15,942,887	K100N	probably benign	Het
Nrg1	C	A	8: 31,918,200	E2*	probably null	Het
Olfr654	T	A	7: 104,588,489	H228Q	probably benign	Het
Pank4	A	G	4: 154,974,634	D408G	possibly damaging	Het
Pcdhb10	T	C	18: 37,411,942	W24R	probably benign	Het
Pcm1	C	T	8: 41,287,738	T968I	probably damaging	Het
Pkib	G	T	10: 57,708,150	M19I	probably benign	Het
Ppy	A	G	11: 102,100,519		probably null	Het
Prdx3	A	C	19: 60,873,183	C39W	possibly damaging	Het
Qrfpr	T	G	3: 36,221,924	N106H	probably benign	Het
Rai14	G	A	15: 10,575,690	T394M	possibly damaging	Het
Rbm12	A	G	2: 156,097,128	L408P	probably damaging	Het
Rdx	T	C	9: 52,065,874	I141T	probably benign	Het
Reep1	T	A	6: 71,708,001	V11E	possibly damaging	Het
Sall4	A	G	2: 168,750,427	S936P	probably damaging	Het
Serac1	A	G	17: 6,051,790	M403T	possibly damaging	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Slc35g2	T	G	9: 100,553,496	I41L	probably benign	Het
Slc39a12	G	A	2: 14,400,323	S242N	probably benign	Het
Slc9a2	T	A	1: 40,761,916	D535E	probably damaging	Het
Spata31d1a	G	T	13: 59,701,645	P890T	probably damaging	Het
Sync	A	G	4: 129,293,439	Q88R	probably benign	Het
Tdrp	A	G	8: 13,974,527		probably benign	Het
Tg	G	T	15: 66,693,319	C1170F	probably damaging	Het
Tnks	A	T	8: 34,851,783	D781E	probably benign	Het
Tnp2	T	A	16: 10,788,343	T87S	possibly damaging	Het
Tpp2	T	C	1: 43,971,715	V554A	probably benign	Het
Traf3ip2	T	C	10: 39,645,739	I431T	probably damaging	Het
Trav9d-4	A	T	14: 52,983,801	H84L	probably damaging	Het
Vmn2r42	T	A	7: 8,184,277	Y782F	probably damaging	Het
Vwf	T	C	6: 125,570,604	S231P	probably damaging	Het
Wdr83os	A	G	8: 85,081,867	S83G	probably damaging	Het
Wdr91	T	A	6: 34,908,299	Q109L	probably damaging	Het
Znrf4	A	G	17: 56,511,864	C148R	possibly damaging	Het

Other mutations in Ralgapa2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00666:Ralgapa2	APN	2	146485136	missense	possibly damaging	0.61
IGL00915:Ralgapa2	APN	2	146342522	missense	probably damaging	1.00
IGL01012:Ralgapa2	APN	2	146421739	missense	possibly damaging	0.95
IGL01018:Ralgapa2	APN	2	146410193	missense	probably benign	0.02
IGL01018:Ralgapa2	APN	2	146410192	missense	probably benign	0.00
IGL01902:Ralgapa2	APN	2	146315014	missense	probably damaging	1.00
IGL02160:Ralgapa2	APN	2	146348440	splice site	probably benign
IGL02321:Ralgapa2	APN	2	146412816	nonsense	probably null
IGL02412:Ralgapa2	APN	2	146412132	missense	probably damaging	0.96
IGL03026:Ralgapa2	APN	2	146460775	splice site	probably benign
IGL03115:Ralgapa2	APN	2	146424814	missense	probably damaging	0.99
IGL03256:Ralgapa2	APN	2	146460712	critical splice donor site	probably null
IGL03379:Ralgapa2	APN	2	146357987	missense	probably benign	0.01
Chow	UTSW	2	146346718	nonsense	probably null
purina	UTSW	2	146333486	missense	probably damaging	1.00
P4748:Ralgapa2	UTSW	2	146346811	nonsense	probably null
R0012:Ralgapa2	UTSW	2	146412752	missense	probably benign
R0012:Ralgapa2	UTSW	2	146412752	missense	probably benign
R0165:Ralgapa2	UTSW	2	146388487	splice site	probably benign
R0344:Ralgapa2	UTSW	2	146346794	missense	possibly damaging	0.69
R0402:Ralgapa2	UTSW	2	146434809	missense	probably damaging	0.98
R0419:Ralgapa2	UTSW	2	146428672	missense	possibly damaging	0.69
R0638:Ralgapa2	UTSW	2	146342192	missense	probably benign	0.00
R0704:Ralgapa2	UTSW	2	146451784	missense	probably damaging	1.00
R0722:Ralgapa2	UTSW	2	146388531	missense	probably damaging	1.00
R0866:Ralgapa2	UTSW	2	146436003	missense	probably damaging	1.00
R1065:Ralgapa2	UTSW	2	146450558	missense	probably benign	0.00
R1212:Ralgapa2	UTSW	2	146357982	missense	probably benign	0.00
R1395:Ralgapa2	UTSW	2	146388500	missense	probably damaging	1.00
R1614:Ralgapa2	UTSW	2	146388612	missense	probably damaging	1.00
R1686:Ralgapa2	UTSW	2	146358000	missense	probably benign	0.09
R1799:Ralgapa2	UTSW	2	146342728	missense	probably benign	0.02
R1905:Ralgapa2	UTSW	2	146387701	missense	probably damaging	1.00
R1956:Ralgapa2	UTSW	2	146460759	missense	probably benign	0.00
R2144:Ralgapa2	UTSW	2	146388604	missense	probably damaging	1.00
R2148:Ralgapa2	UTSW	2	146431887	missense	probably benign	0.02
R2219:Ralgapa2	UTSW	2	146421679	missense	probably benign	0.09
R2220:Ralgapa2	UTSW	2	146421679	missense	probably benign	0.09
R2261:Ralgapa2	UTSW	2	146342683	missense	probably damaging	1.00
R2402:Ralgapa2	UTSW	2	146353192	missense	probably damaging	1.00
R2495:Ralgapa2	UTSW	2	146361400	missense	possibly damaging	0.82
R3752:Ralgapa2	UTSW	2	146421631	missense	possibly damaging	0.94
R3953:Ralgapa2	UTSW	2	146435964	missense	probably damaging	1.00
R3956:Ralgapa2	UTSW	2	146435964	missense	probably damaging	1.00
R4177:Ralgapa2	UTSW	2	146485163	missense	probably damaging	1.00
R4182:Ralgapa2	UTSW	2	146435994	missense	probably damaging	1.00
R4193:Ralgapa2	UTSW	2	146342573	missense	probably damaging	1.00
R4332:Ralgapa2	UTSW	2	146260368	missense	probably benign	0.10
R4507:Ralgapa2	UTSW	2	146353248	missense	probably benign	0.11
R4574:Ralgapa2	UTSW	2	146435999	missense	probably damaging	1.00
R4585:Ralgapa2	UTSW	2	146315024	missense	probably damaging	0.99
R4627:Ralgapa2	UTSW	2	146361453	missense	possibly damaging	0.88
R4647:Ralgapa2	UTSW	2	146387629	missense	possibly damaging	0.69
R4677:Ralgapa2	UTSW	2	146345467	missense	possibly damaging	0.82
R4724:Ralgapa2	UTSW	2	146345533	missense	possibly damaging	0.46
R4831:Ralgapa2	UTSW	2	146405067	intron	probably benign
R4962:Ralgapa2	UTSW	2	146434834	nonsense	probably null
R4993:Ralgapa2	UTSW	2	146447311	missense	probably damaging	1.00
R5041:Ralgapa2	UTSW	2	146485151	missense	probably benign	0.00
R5120:Ralgapa2	UTSW	2	146412084	missense	probably benign	0.26
R5185:Ralgapa2	UTSW	2	146388486	splice site	probably null
R5393:Ralgapa2	UTSW	2	146345455	missense	probably damaging	1.00
R5428:Ralgapa2	UTSW	2	146334494	missense	probably damaging	0.96
R5439:Ralgapa2	UTSW	2	146342510	missense	probably benign	0.08
R5476:Ralgapa2	UTSW	2	146447436	missense	probably benign
R5695:Ralgapa2	UTSW	2	146333477	missense	probably damaging	1.00
R5705:Ralgapa2	UTSW	2	146449273	missense	probably damaging	1.00
R5718:Ralgapa2	UTSW	2	146453406	splice site	probably null
R5817:Ralgapa2	UTSW	2	146333486	missense	probably damaging	1.00
R5877:Ralgapa2	UTSW	2	146388569	missense	probably damaging	1.00
R5994:Ralgapa2	UTSW	2	146361453	missense	probably benign	0.00
R6048:Ralgapa2	UTSW	2	146434845	missense	possibly damaging	0.46
R6158:Ralgapa2	UTSW	2	146424676	missense	possibly damaging	0.69
R6169:Ralgapa2	UTSW	2	146450465	missense	probably damaging	1.00
R6280:Ralgapa2	UTSW	2	146342209	missense	probably damaging	1.00
R6301:Ralgapa2	UTSW	2	146327411	missense	possibly damaging	0.94
R6650:Ralgapa2	UTSW	2	146388502	missense	probably damaging	1.00
R6959:Ralgapa2	UTSW	2	146342701	missense	probably damaging	0.98
R7020:Ralgapa2	UTSW	2	146346718	nonsense	probably null
R7035:Ralgapa2	UTSW	2	146511857	missense	probably damaging	1.00
R7167:Ralgapa2	UTSW	2	146348454	missense	probably benign
R7186:Ralgapa2	UTSW	2	146388486	splice site	probably null
R7252:Ralgapa2	UTSW	2	146342751	critical splice acceptor site	probably null
R7266:Ralgapa2	UTSW	2	146334568	missense	probably damaging	1.00
R7371:Ralgapa2	UTSW	2	146347126	missense	probably benign	0.05
R7432:Ralgapa2	UTSW	2	146434856	missense	probably benign	0.41
R7470:Ralgapa2	UTSW	2	146424667	missense	probably damaging	1.00
R7663:Ralgapa2	UTSW	2	146418415	missense	probably benign	0.01
R7780:Ralgapa2	UTSW	2	146342414	missense	probably benign	0.14
R7973:Ralgapa2	UTSW	2	146388561	missense	possibly damaging	0.88
R8018:Ralgapa2	UTSW	2	146340391	missense	probably damaging	1.00
R8063:Ralgapa2	UTSW	2	146443855	missense	probably damaging	1.00
R8070:Ralgapa2	UTSW	2	146353279	missense	probably damaging	0.98
R8264:Ralgapa2	UTSW	2	146333450	missense	possibly damaging	0.90
R8309:Ralgapa2	UTSW	2	146404866	missense	possibly damaging	0.66
R8409:Ralgapa2	UTSW	2	146244977	missense
R8474:Ralgapa2	UTSW	2	146424830	missense	probably damaging	1.00
R8487:Ralgapa2	UTSW	2	146388543	missense	probably damaging	1.00
R8492:Ralgapa2	UTSW	2	146342604	missense	possibly damaging	0.50
R8733:Ralgapa2	UTSW	2	146424763	missense	probably damaging	1.00
R8856:Ralgapa2	UTSW	2	146342219	missense	probably benign	0.30
R8858:Ralgapa2	UTSW	2	146260365	critical splice donor site	probably null
R8862:Ralgapa2	UTSW	2	146424811	missense	probably benign	0.41
R9146:Ralgapa2	UTSW	2	146342332	missense	probably benign
R9324:Ralgapa2	UTSW	2	146460725	missense	probably damaging	1.00
R9439:Ralgapa2	UTSW	2	146412138	missense	probably benign
R9457:Ralgapa2	UTSW	2	146334554	missense	probably damaging	0.99
RF019:Ralgapa2	UTSW	2	146361503	missense	possibly damaging	0.53
X0019:Ralgapa2	UTSW	2	146388652	missense	possibly damaging	0.56
Z1088:Ralgapa2	UTSW	2	146434905	missense	probably benign	0.20

Predicted Primers

PCR Primer
(F):5'- CACCTTGGCAACCACTGATTC -3'
(R):5'- ACTGAGTATACACAGGGACAATTCTG -3'

Sequencing Primer
(F):5'- TGGCAACCACTGATTCTCTACAG -3'
(R):5'- CACAGGGACAATTCTGTTTATTTTC -3'

Posted On

2015-11-11