Incidental Mutation 'R4760:Rbm12'
ID 356776
Institutional Source Beutler Lab
Gene Symbol Rbm12
Ensembl Gene ENSMUSG00000089824
Gene Name RNA binding motif protein 12
Synonyms SWAN, 9430070C08Rik, 5730420G12Rik
MMRRC Submission 041974-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.902) question?
Stock # R4760 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 155933876-155953847 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 155939048 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 408 (L408P)
Ref Sequence ENSEMBL: ENSMUSP00000105233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059647] [ENSMUST00000079312] [ENSMUST00000109604] [ENSMUST00000109607] [ENSMUST00000109608] [ENSMUST00000132494] [ENSMUST00000154889] [ENSMUST00000133921] [ENSMUST00000138068] [ENSMUST00000128499] [ENSMUST00000142960] [ENSMUST00000131377] [ENSMUST00000136296] [ENSMUST00000147627] [ENSMUST00000153634] [ENSMUST00000183518] [ENSMUST00000184265] [ENSMUST00000184899] [ENSMUST00000183972] [ENSMUST00000184152]
AlphaFold Q8R4X3
Predicted Effect probably damaging
Transcript: ENSMUST00000059647
AA Change: L408P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000050461
Gene: ENSMUSG00000089824
AA Change: L408P

DomainStartEndE-ValueType
Pfam:RRM_6 5 70 5e-5 PFAM
low complexity region 98 116 N/A INTRINSIC
low complexity region 161 260 N/A INTRINSIC
RRM 305 375 1.05e-1 SMART
RRM 431 503 2.73e-7 SMART
RRM 545 617 8.73e-6 SMART
low complexity region 655 767 N/A INTRINSIC
low complexity region 781 812 N/A INTRINSIC
low complexity region 866 908 N/A INTRINSIC
RRM 917 990 1.03e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000079312
SMART Domains Protein: ENSMUSP00000078292
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 137 242 8.76e-12 SMART
VWA 282 468 8.96e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109604
AA Change: L408P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105233
Gene: ENSMUSG00000089824
AA Change: L408P

DomainStartEndE-ValueType
Pfam:RRM_6 5 70 1.1e-5 PFAM
low complexity region 98 116 N/A INTRINSIC
low complexity region 161 260 N/A INTRINSIC
RRM 305 375 1.05e-1 SMART
RRM 431 503 2.73e-7 SMART
RRM 545 617 8.73e-6 SMART
low complexity region 655 767 N/A INTRINSIC
low complexity region 781 812 N/A INTRINSIC
low complexity region 866 908 N/A INTRINSIC
RRM 917 990 1.03e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109607
SMART Domains Protein: ENSMUSP00000105236
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 137 242 8.76e-12 SMART
VWA 282 484 9.5e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109608
SMART Domains Protein: ENSMUSP00000105237
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 137 242 8.76e-12 SMART
VWA 282 484 9.5e-15 SMART
Predicted Effect unknown
Transcript: ENSMUST00000127956
AA Change: L319P
SMART Domains Protein: ENSMUSP00000114923
Gene: ENSMUSG00000098950
AA Change: L319P

DomainStartEndE-ValueType
low complexity region 10 28 N/A INTRINSIC
low complexity region 73 172 N/A INTRINSIC
RRM 217 287 1.05e-1 SMART
RRM 343 415 2.73e-7 SMART
RRM 457 529 8.73e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000132494
AA Change: L408P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139175
Gene: ENSMUSG00000098950
AA Change: L408P

DomainStartEndE-ValueType
Pfam:RRM_6 5 70 1.5e-5 PFAM
low complexity region 98 116 N/A INTRINSIC
low complexity region 161 260 N/A INTRINSIC
RRM 305 375 1.05e-1 SMART
RRM 431 503 2.73e-7 SMART
RRM 545 617 8.73e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142975
Predicted Effect probably benign
Transcript: ENSMUST00000154889
SMART Domains Protein: ENSMUSP00000118140
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133921
SMART Domains Protein: ENSMUSP00000122644
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
Pfam:C2 139 178 3.3e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138068
SMART Domains Protein: ENSMUSP00000119519
Gene: ENSMUSG00000089824

DomainStartEndE-ValueType
PDB:2DB1|A 2 86 5e-8 PDB
Blast:RRM_2 4 72 1e-30 BLAST
low complexity region 98 116 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128499
SMART Domains Protein: ENSMUSP00000118067
Gene: ENSMUSG00000089824

DomainStartEndE-ValueType
PDB:2DB1|A 2 86 6e-8 PDB
Blast:RRM_2 4 72 1e-30 BLAST
low complexity region 98 116 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142960
SMART Domains Protein: ENSMUSP00000121299
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 2.4e-11 SMART
C2 123 206 3e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159952
SMART Domains Protein: ENSMUSP00000124101
Gene: ENSMUSG00000098950

DomainStartEndE-ValueType
SCOP:d1eg5a_ 3 82 2e-15 SMART
PDB:1P3W|A 3 86 3e-34 PDB
low complexity region 93 106 N/A INTRINSIC
Blast:RRM_2 124 160 2e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000131377
SMART Domains Protein: ENSMUSP00000120731
Gene: ENSMUSG00000089824

DomainStartEndE-ValueType
PDB:2DB1|A 2 86 1e-7 PDB
Blast:RRM_2 4 72 4e-29 BLAST
low complexity region 98 116 N/A INTRINSIC
low complexity region 161 260 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136296
SMART Domains Protein: ENSMUSP00000122994
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 123 218 7.88e-5 SMART
Pfam:Copine 279 378 2.3e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147627
SMART Domains Protein: ENSMUSP00000116982
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 137 242 8.76e-12 SMART
Pfam:Copine 303 350 1.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153634
SMART Domains Protein: ENSMUSP00000115167
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 123 218 7.88e-5 SMART
Pfam:Copine 279 325 4.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183518
SMART Domains Protein: ENSMUSP00000139010
Gene: ENSMUSG00000098950

DomainStartEndE-ValueType
Blast:RRM_2 4 40 4e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000184265
SMART Domains Protein: ENSMUSP00000138888
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162612
SMART Domains Protein: ENSMUSP00000125190
Gene: ENSMUSG00000098950

DomainStartEndE-ValueType
SCOP:d1eg5a_ 3 82 1e-15 SMART
PDB:1P3W|A 3 86 2e-34 PDB
low complexity region 93 106 N/A INTRINSIC
Blast:RRM_2 124 161 1e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000184899
SMART Domains Protein: ENSMUSP00000139177
Gene: ENSMUSG00000098950

DomainStartEndE-ValueType
Blast:RRM_2 4 54 2e-25 BLAST
SCOP:d2u1a__ 9 68 6e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183972
Predicted Effect probably benign
Transcript: ENSMUST00000160165
SMART Domains Protein: ENSMUSP00000124858
Gene: ENSMUSG00000098950

DomainStartEndE-ValueType
PDB:1P3W|A 3 28 1e-6 PDB
low complexity region 36 50 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184152
SMART Domains Protein: ENSMUSP00000139035
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
Meta Mutation Damage Score 0.0670 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: This gene encodes a protein that contains several RNA-binding motifs, potential transmembrane domains, and proline-rich regions. This gene and the gene for copine I overlap at map location 2 H2. Two alternatively spliced transcript variants have been identified for this gene. Both variants encode the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU mutation exhibit open neural tube and embryonic growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530053G22Rik A G 6: 60,379,086 (GRCm39) noncoding transcript Het
Abcc2 A T 19: 43,798,920 (GRCm39) Y512F probably benign Het
Adgrb1 T A 15: 74,443,312 (GRCm39) I51N probably damaging Het
Adhfe1 A G 1: 9,633,748 (GRCm39) Y332C probably damaging Het
Ambn C T 5: 88,615,566 (GRCm39) L317F probably damaging Het
Amn1 T C 6: 149,086,611 (GRCm39) Y17C probably benign Het
Apoa5 T C 9: 46,181,593 (GRCm39) V223A probably damaging Het
Best3 A T 10: 116,860,699 (GRCm39) H653L probably benign Het
Btnl2 C A 17: 34,582,169 (GRCm39) S245Y probably damaging Het
Camk1d A G 2: 5,366,867 (GRCm39) L116P probably damaging Het
Catsperg2 T A 7: 29,405,060 (GRCm39) D698V probably damaging Het
Cd33 T C 7: 43,178,919 (GRCm39) T307A probably benign Het
Cdk8 C T 5: 146,229,476 (GRCm39) S230L probably benign Het
Cfap69 C T 5: 5,696,939 (GRCm39) C119Y probably damaging Het
Chat T C 14: 32,175,694 (GRCm39) N122S probably benign Het
Col20a1 A T 2: 180,626,196 (GRCm39) probably benign Het
Cyp2j9 A T 4: 96,457,028 (GRCm39) L481Q probably damaging Het
Dab1 A C 4: 104,589,342 (GRCm39) S550R probably damaging Het
Dlgap2 A C 8: 14,823,380 (GRCm39) Q533P probably damaging Het
Eif4g3 A T 4: 137,811,629 (GRCm39) Q31L possibly damaging Het
Ets2 G A 16: 95,520,087 (GRCm39) V438M probably damaging Het
Eva1c G A 16: 90,701,138 (GRCm39) D258N probably benign Het
Fastkd2 A G 1: 63,785,045 (GRCm39) H477R probably benign Het
Fga T G 3: 82,938,821 (GRCm39) S399A probably benign Het
Fmo4 T A 1: 162,637,396 (GRCm39) E32V probably damaging Het
Gm7204 T A 16: 48,039,051 (GRCm39) noncoding transcript Het
Gpi-ps G A 8: 5,690,473 (GRCm39) noncoding transcript Het
Hhipl1 A G 12: 108,286,336 (GRCm39) I548V probably damaging Het
Hsfy2 T C 1: 56,676,349 (GRCm39) T63A probably benign Het
Igf2r A G 17: 12,922,352 (GRCm39) V1254A possibly damaging Het
Ighv8-4 A T 12: 114,987,667 (GRCm39) D110E probably damaging Het
Igkv14-130 T C 6: 67,768,446 (GRCm39) S101P probably benign Het
Igkv9-120 G T 6: 68,027,351 (GRCm39) R88S possibly damaging Het
Ipo5 T C 14: 121,179,054 (GRCm39) V779A probably benign Het
Itpr1 C T 6: 108,326,593 (GRCm39) T105I probably benign Het
Kalrn T C 16: 34,018,857 (GRCm39) M670V probably damaging Het
Kdm8 T A 7: 125,054,431 (GRCm39) probably null Het
Kics2 T C 10: 121,575,912 (GRCm39) V11A probably damaging Het
L3hypdh T C 12: 72,124,016 (GRCm39) I281V probably benign Het
Lins1 T G 7: 66,364,435 (GRCm39) probably benign Het
Map4k5 T A 12: 69,871,372 (GRCm39) I517L possibly damaging Het
Marchf2 G T 17: 33,928,890 (GRCm39) T2K probably damaging Het
Mlkl C G 8: 112,046,348 (GRCm39) probably null Het
Mllt1 A G 17: 57,209,630 (GRCm39) M160T probably benign Het
Mmp15 G A 8: 96,094,824 (GRCm39) A233T possibly damaging Het
Moxd2 C A 6: 40,868,537 (GRCm39) T23N probably benign Het
Nop53 C A 7: 15,676,812 (GRCm39) K100N probably benign Het
Nrg1 C A 8: 32,408,228 (GRCm39) E2* probably null Het
Or52u1 T A 7: 104,237,696 (GRCm39) H228Q probably benign Het
Pank4 A G 4: 155,059,091 (GRCm39) D408G possibly damaging Het
Pcdhb10 T C 18: 37,544,995 (GRCm39) W24R probably benign Het
Pcm1 C T 8: 41,740,775 (GRCm39) T968I probably damaging Het
Pkib G T 10: 57,584,246 (GRCm39) M19I probably benign Het
Ppy A G 11: 101,991,345 (GRCm39) probably null Het
Pramel21 G A 4: 143,343,801 (GRCm39) R367K probably benign Het
Prdx3 A C 19: 60,861,621 (GRCm39) C39W possibly damaging Het
Qrfpr T G 3: 36,276,073 (GRCm39) N106H probably benign Het
Rai14 G A 15: 10,575,776 (GRCm39) T394M possibly damaging Het
Ralgapa2 A T 2: 146,188,669 (GRCm39) L1371Q probably benign Het
Rdx T C 9: 51,977,174 (GRCm39) I141T probably benign Het
Reep1 T A 6: 71,684,985 (GRCm39) V11E possibly damaging Het
Relch T A 1: 105,649,030 (GRCm39) M723K probably benign Het
Sall4 A G 2: 168,592,347 (GRCm39) S936P probably damaging Het
Serac1 A G 17: 6,102,065 (GRCm39) M403T possibly damaging Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Slc35g2 T G 9: 100,435,549 (GRCm39) I41L probably benign Het
Slc39a12 G A 2: 14,405,134 (GRCm39) S242N probably benign Het
Slc9a2 T A 1: 40,801,076 (GRCm39) D535E probably damaging Het
Spata31d1a G T 13: 59,849,459 (GRCm39) P890T probably damaging Het
Sync A G 4: 129,187,232 (GRCm39) Q88R probably benign Het
Tdrp A G 8: 14,024,527 (GRCm39) probably benign Het
Tg G T 15: 66,565,168 (GRCm39) C1170F probably damaging Het
Tnks A T 8: 35,318,937 (GRCm39) D781E probably benign Het
Tnp2 T A 16: 10,606,207 (GRCm39) T87S possibly damaging Het
Tpp2 T C 1: 44,010,875 (GRCm39) V554A probably benign Het
Traf3ip2 T C 10: 39,521,735 (GRCm39) I431T probably damaging Het
Trav9d-4 A T 14: 53,221,258 (GRCm39) H84L probably damaging Het
Vmn2r42 T A 7: 8,187,276 (GRCm39) Y782F probably damaging Het
Vwf T C 6: 125,547,567 (GRCm39) S231P probably damaging Het
Wdr83os A G 8: 85,808,496 (GRCm39) S83G probably damaging Het
Wdr91 T A 6: 34,885,234 (GRCm39) Q109L probably damaging Het
Znrf4 A G 17: 56,818,864 (GRCm39) C148R possibly damaging Het
Other mutations in Rbm12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:Rbm12 APN 2 155,937,961 (GRCm39) intron probably benign
IGL01307:Rbm12 APN 2 155,937,302 (GRCm39) intron probably benign
IGL02474:Rbm12 APN 2 155,940,017 (GRCm39) missense probably damaging 1.00
IGL02596:Rbm12 APN 2 155,937,480 (GRCm39) intron probably benign
IGL02601:Rbm12 APN 2 155,937,480 (GRCm39) intron probably benign
IGL02603:Rbm12 APN 2 155,937,480 (GRCm39) intron probably benign
IGL02608:Rbm12 APN 2 155,937,818 (GRCm39) intron probably benign
IGL02679:Rbm12 APN 2 155,937,480 (GRCm39) intron probably benign
IGL02691:Rbm12 APN 2 155,937,480 (GRCm39) intron probably benign
IGL02693:Rbm12 APN 2 155,937,480 (GRCm39) intron probably benign
IGL02702:Rbm12 APN 2 155,937,480 (GRCm39) intron probably benign
IGL02703:Rbm12 APN 2 155,937,480 (GRCm39) intron probably benign
IGL03407:Rbm12 APN 2 155,939,484 (GRCm39) nonsense probably null
IGL02991:Rbm12 UTSW 2 155,937,480 (GRCm39) intron probably benign
R0310:Rbm12 UTSW 2 155,937,644 (GRCm39) intron probably benign
R1213:Rbm12 UTSW 2 155,939,412 (GRCm39) nonsense probably null
R1280:Rbm12 UTSW 2 155,938,749 (GRCm39) missense probably damaging 1.00
R1511:Rbm12 UTSW 2 155,939,456 (GRCm39) missense probably damaging 0.98
R1951:Rbm12 UTSW 2 155,939,133 (GRCm39) missense probably damaging 0.99
R2131:Rbm12 UTSW 2 155,937,430 (GRCm39) nonsense probably null
R2133:Rbm12 UTSW 2 155,937,430 (GRCm39) nonsense probably null
R2883:Rbm12 UTSW 2 155,938,995 (GRCm39) missense probably damaging 0.98
R4783:Rbm12 UTSW 2 155,938,484 (GRCm39) missense possibly damaging 0.95
R4784:Rbm12 UTSW 2 155,938,484 (GRCm39) missense possibly damaging 0.95
R4785:Rbm12 UTSW 2 155,938,484 (GRCm39) missense possibly damaging 0.95
R4794:Rbm12 UTSW 2 155,937,489 (GRCm39) intron probably benign
R5057:Rbm12 UTSW 2 155,938,806 (GRCm39) missense probably benign 0.18
R5383:Rbm12 UTSW 2 155,945,285 (GRCm39) utr 5 prime probably benign
R5599:Rbm12 UTSW 2 155,938,713 (GRCm39) nonsense probably null
R5979:Rbm12 UTSW 2 155,939,679 (GRCm39) intron probably benign
R6083:Rbm12 UTSW 2 155,939,646 (GRCm39) intron probably benign
R6769:Rbm12 UTSW 2 155,939,375 (GRCm39) missense possibly damaging 0.95
R6771:Rbm12 UTSW 2 155,939,375 (GRCm39) missense possibly damaging 0.95
R7233:Rbm12 UTSW 2 155,937,894 (GRCm39) missense unknown
R7424:Rbm12 UTSW 2 155,939,223 (GRCm39) missense possibly damaging 0.57
R7483:Rbm12 UTSW 2 155,940,138 (GRCm39) missense unknown
R7643:Rbm12 UTSW 2 155,940,137 (GRCm39) missense unknown
R7848:Rbm12 UTSW 2 155,938,136 (GRCm39) missense probably benign 0.01
R8556:Rbm12 UTSW 2 155,938,481 (GRCm39) missense probably damaging 1.00
R8866:Rbm12 UTSW 2 155,938,693 (GRCm39) nonsense probably null
R8875:Rbm12 UTSW 2 155,938,841 (GRCm39) missense probably damaging 1.00
R9054:Rbm12 UTSW 2 155,937,481 (GRCm39) missense unknown
R9115:Rbm12 UTSW 2 155,938,030 (GRCm39) intron probably benign
R9179:Rbm12 UTSW 2 155,938,463 (GRCm39) missense probably benign 0.05
R9262:Rbm12 UTSW 2 155,939,317 (GRCm39) missense possibly damaging 0.49
R9495:Rbm12 UTSW 2 155,939,738 (GRCm39) missense unknown
R9656:Rbm12 UTSW 2 155,940,121 (GRCm39) missense unknown
R9701:Rbm12 UTSW 2 155,938,166 (GRCm39) missense probably benign 0.01
R9759:Rbm12 UTSW 2 155,938,546 (GRCm39) missense probably benign 0.03
RF001:Rbm12 UTSW 2 155,937,995 (GRCm39) intron probably benign
RF021:Rbm12 UTSW 2 155,938,026 (GRCm39) intron probably benign
RF028:Rbm12 UTSW 2 155,938,050 (GRCm39) frame shift probably null
RF029:Rbm12 UTSW 2 155,938,015 (GRCm39) intron probably benign
RF033:Rbm12 UTSW 2 155,938,002 (GRCm39) intron probably benign
RF033:Rbm12 UTSW 2 155,938,000 (GRCm39) intron probably benign
RF033:Rbm12 UTSW 2 155,937,999 (GRCm39) intron probably benign
RF033:Rbm12 UTSW 2 155,938,004 (GRCm39) intron probably benign
RF033:Rbm12 UTSW 2 155,938,003 (GRCm39) intron probably benign
RF038:Rbm12 UTSW 2 155,938,026 (GRCm39) intron probably benign
Predicted Primers PCR Primer
(F):5'- TTATGACGACAGAGAGCAGCC -3'
(R):5'- CCCCTCAAGATACATTTGAAGC -3'

Sequencing Primer
(F):5'- GAGCAGCCTTATAGTCAGCATCATTC -3'
(R):5'- CATTTGAAGCTTTGAAACGGAACAG -3'
Posted On 2015-11-11