Incidental Mutation 'R4760:Rbm12'
List |< first << previous [record 61 of 83] next >> last >|
ID356776
Institutional Source Beutler Lab
Gene Symbol Rbm12
Ensembl Gene ENSMUSG00000089824
Gene NameRNA binding motif protein 12
SynonymsSWAN, 5730420G12Rik, 9430070C08Rik
MMRRC Submission 041974-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.906) question?
Stock #R4760 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location156091958-156111978 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 156097128 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 408 (L408P)
Ref Sequence ENSEMBL: ENSMUSP00000105233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059647] [ENSMUST00000079312] [ENSMUST00000109604] [ENSMUST00000109607] [ENSMUST00000109608] [ENSMUST00000128499] [ENSMUST00000131377] [ENSMUST00000132494] [ENSMUST00000133921] [ENSMUST00000136296] [ENSMUST00000138068] [ENSMUST00000142960] [ENSMUST00000147627] [ENSMUST00000153634] [ENSMUST00000154889] [ENSMUST00000183518] [ENSMUST00000183972] [ENSMUST00000184152] [ENSMUST00000184265] [ENSMUST00000184899]
Predicted Effect probably damaging
Transcript: ENSMUST00000059647
AA Change: L408P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000050461
Gene: ENSMUSG00000089824
AA Change: L408P

DomainStartEndE-ValueType
Pfam:RRM_6 5 70 5e-5 PFAM
low complexity region 98 116 N/A INTRINSIC
low complexity region 161 260 N/A INTRINSIC
RRM 305 375 1.05e-1 SMART
RRM 431 503 2.73e-7 SMART
RRM 545 617 8.73e-6 SMART
low complexity region 655 767 N/A INTRINSIC
low complexity region 781 812 N/A INTRINSIC
low complexity region 866 908 N/A INTRINSIC
RRM 917 990 1.03e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000079312
SMART Domains Protein: ENSMUSP00000078292
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 137 242 8.76e-12 SMART
VWA 282 468 8.96e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109604
AA Change: L408P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105233
Gene: ENSMUSG00000089824
AA Change: L408P

DomainStartEndE-ValueType
Pfam:RRM_6 5 70 1.1e-5 PFAM
low complexity region 98 116 N/A INTRINSIC
low complexity region 161 260 N/A INTRINSIC
RRM 305 375 1.05e-1 SMART
RRM 431 503 2.73e-7 SMART
RRM 545 617 8.73e-6 SMART
low complexity region 655 767 N/A INTRINSIC
low complexity region 781 812 N/A INTRINSIC
low complexity region 866 908 N/A INTRINSIC
RRM 917 990 1.03e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109607
SMART Domains Protein: ENSMUSP00000105236
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 137 242 8.76e-12 SMART
VWA 282 484 9.5e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109608
SMART Domains Protein: ENSMUSP00000105237
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 137 242 8.76e-12 SMART
VWA 282 484 9.5e-15 SMART
Predicted Effect unknown
Transcript: ENSMUST00000127956
AA Change: L319P
SMART Domains Protein: ENSMUSP00000114923
Gene: ENSMUSG00000098950
AA Change: L319P

DomainStartEndE-ValueType
low complexity region 10 28 N/A INTRINSIC
low complexity region 73 172 N/A INTRINSIC
RRM 217 287 1.05e-1 SMART
RRM 343 415 2.73e-7 SMART
RRM 457 529 8.73e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128499
SMART Domains Protein: ENSMUSP00000118067
Gene: ENSMUSG00000089824

DomainStartEndE-ValueType
PDB:2DB1|A 2 86 6e-8 PDB
Blast:RRM_2 4 72 1e-30 BLAST
low complexity region 98 116 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131377
SMART Domains Protein: ENSMUSP00000120731
Gene: ENSMUSG00000089824

DomainStartEndE-ValueType
PDB:2DB1|A 2 86 1e-7 PDB
Blast:RRM_2 4 72 4e-29 BLAST
low complexity region 98 116 N/A INTRINSIC
low complexity region 161 260 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000132494
AA Change: L408P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139175
Gene: ENSMUSG00000098950
AA Change: L408P

DomainStartEndE-ValueType
Pfam:RRM_6 5 70 1.5e-5 PFAM
low complexity region 98 116 N/A INTRINSIC
low complexity region 161 260 N/A INTRINSIC
RRM 305 375 1.05e-1 SMART
RRM 431 503 2.73e-7 SMART
RRM 545 617 8.73e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133921
SMART Domains Protein: ENSMUSP00000122644
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
Pfam:C2 139 178 3.3e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136296
SMART Domains Protein: ENSMUSP00000122994
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 123 218 7.88e-5 SMART
Pfam:Copine 279 378 2.3e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138068
SMART Domains Protein: ENSMUSP00000119519
Gene: ENSMUSG00000089824

DomainStartEndE-ValueType
PDB:2DB1|A 2 86 5e-8 PDB
Blast:RRM_2 4 72 1e-30 BLAST
low complexity region 98 116 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142960
SMART Domains Protein: ENSMUSP00000121299
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 2.4e-11 SMART
C2 123 206 3e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142975
Predicted Effect probably benign
Transcript: ENSMUST00000147627
SMART Domains Protein: ENSMUSP00000116982
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 137 242 8.76e-12 SMART
Pfam:Copine 303 350 1.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153634
SMART Domains Protein: ENSMUSP00000115167
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 123 218 7.88e-5 SMART
Pfam:Copine 279 325 4.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154889
SMART Domains Protein: ENSMUSP00000118140
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159952
SMART Domains Protein: ENSMUSP00000124101
Gene: ENSMUSG00000098950

DomainStartEndE-ValueType
SCOP:d1eg5a_ 3 82 2e-15 SMART
PDB:1P3W|A 3 86 3e-34 PDB
low complexity region 93 106 N/A INTRINSIC
Blast:RRM_2 124 160 2e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000160165
SMART Domains Protein: ENSMUSP00000124858
Gene: ENSMUSG00000098950

DomainStartEndE-ValueType
PDB:1P3W|A 3 28 1e-6 PDB
low complexity region 36 50 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162612
SMART Domains Protein: ENSMUSP00000125190
Gene: ENSMUSG00000098950

DomainStartEndE-ValueType
SCOP:d1eg5a_ 3 82 1e-15 SMART
PDB:1P3W|A 3 86 2e-34 PDB
low complexity region 93 106 N/A INTRINSIC
Blast:RRM_2 124 161 1e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000183518
SMART Domains Protein: ENSMUSP00000139010
Gene: ENSMUSG00000098950

DomainStartEndE-ValueType
Blast:RRM_2 4 40 4e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000183972
Predicted Effect probably benign
Transcript: ENSMUST00000184152
SMART Domains Protein: ENSMUSP00000139035
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184265
SMART Domains Protein: ENSMUSP00000138888
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184899
SMART Domains Protein: ENSMUSP00000139177
Gene: ENSMUSG00000098950

DomainStartEndE-ValueType
Blast:RRM_2 4 54 2e-25 BLAST
SCOP:d2u1a__ 9 68 6e-3 SMART
Meta Mutation Damage Score 0.0670 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: This gene encodes a protein that contains several RNA-binding motifs, potential transmembrane domains, and proline-rich regions. This gene and the gene for copine I overlap at map location 2 H2. Two alternatively spliced transcript variants have been identified for this gene. Both variants encode the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU mutation exhibit open neural tube and embryonic growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,721,305 M723K probably benign Het
A530053G22Rik A G 6: 60,402,101 noncoding transcript Het
Abcc2 A T 19: 43,810,481 Y512F probably benign Het
Adgrb1 T A 15: 74,571,463 I51N probably damaging Het
Adhfe1 A G 1: 9,563,523 Y332C probably damaging Het
Ambn C T 5: 88,467,707 L317F probably damaging Het
Amn1 T C 6: 149,185,113 Y17C probably benign Het
Apoa5 T C 9: 46,270,295 V223A probably damaging Het
BC048403 T C 10: 121,740,007 V11A probably damaging Het
Best3 A T 10: 117,024,794 H653L probably benign Het
Btnl2 C A 17: 34,363,195 S245Y probably damaging Het
Camk1d A G 2: 5,362,056 L116P probably damaging Het
Catsperg2 T A 7: 29,705,635 D698V probably damaging Het
Cd33 T C 7: 43,529,495 T307A probably benign Het
Cdk8 C T 5: 146,292,666 S230L probably benign Het
Cfap69 C T 5: 5,646,939 C119Y probably damaging Het
Chat T C 14: 32,453,737 N122S probably benign Het
Col20a1 A T 2: 180,984,403 probably benign Het
Cyp2j9 A T 4: 96,568,791 L481Q probably damaging Het
Dab1 A C 4: 104,732,145 S550R probably damaging Het
Dlgap2 A C 8: 14,773,380 Q533P probably damaging Het
Eif4g3 A T 4: 138,084,318 Q31L possibly damaging Het
Ets2 G A 16: 95,719,043 V438M probably damaging Het
Eva1c G A 16: 90,904,250 D258N probably benign Het
Fastkd2 A G 1: 63,745,886 H477R probably benign Het
Fga T G 3: 83,031,514 S399A probably benign Het
Fmo4 T A 1: 162,809,827 E32V probably damaging Het
Gm13083 G A 4: 143,617,231 R367K probably benign Het
Gm1840 G A 8: 5,640,473 noncoding transcript Het
Gm7204 T A 16: 48,218,688 noncoding transcript Het
Hhipl1 A G 12: 108,320,077 I548V probably damaging Het
Hsfy2 T C 1: 56,637,190 T63A probably benign Het
Igf2r A G 17: 12,703,465 V1254A possibly damaging Het
Ighv8-4 A T 12: 115,024,047 D110E probably damaging Het
Igkv14-130 T C 6: 67,791,462 S101P probably benign Het
Igkv9-120 G T 6: 68,050,367 R88S possibly damaging Het
Ipo5 T C 14: 120,941,642 V779A probably benign Het
Itpr1 C T 6: 108,349,632 T105I probably benign Het
Kalrn T C 16: 34,198,487 M670V probably damaging Het
Kdm8 T A 7: 125,455,259 probably null Het
L3hypdh T C 12: 72,077,242 I281V probably benign Het
Lins1 T G 7: 66,714,687 probably benign Het
Map4k5 T A 12: 69,824,598 I517L possibly damaging Het
March2 G T 17: 33,709,916 T2K probably damaging Het
Mlkl C G 8: 111,319,716 probably null Het
Mllt1 A G 17: 56,902,630 M160T probably benign Het
Mmp15 G A 8: 95,368,196 A233T possibly damaging Het
Moxd2 C A 6: 40,891,603 T23N probably benign Het
Nop53 C A 7: 15,942,887 K100N probably benign Het
Nrg1 C A 8: 31,918,200 E2* probably null Het
Olfr654 T A 7: 104,588,489 H228Q probably benign Het
Pank4 A G 4: 154,974,634 D408G possibly damaging Het
Pcdhb10 T C 18: 37,411,942 W24R probably benign Het
Pcm1 C T 8: 41,287,738 T968I probably damaging Het
Pkib G T 10: 57,708,150 M19I probably benign Het
Ppy A G 11: 102,100,519 probably null Het
Prdx3 A C 19: 60,873,183 C39W possibly damaging Het
Qrfpr T G 3: 36,221,924 N106H probably benign Het
Rai14 G A 15: 10,575,690 T394M possibly damaging Het
Ralgapa2 A T 2: 146,346,749 L1371Q probably benign Het
Rdx T C 9: 52,065,874 I141T probably benign Het
Reep1 T A 6: 71,708,001 V11E possibly damaging Het
Sall4 A G 2: 168,750,427 S936P probably damaging Het
Serac1 A G 17: 6,051,790 M403T possibly damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc35g2 T G 9: 100,553,496 I41L probably benign Het
Slc39a12 G A 2: 14,400,323 S242N probably benign Het
Slc9a2 T A 1: 40,761,916 D535E probably damaging Het
Spata31d1a G T 13: 59,701,645 P890T probably damaging Het
Sync A G 4: 129,293,439 Q88R probably benign Het
Tdrp A G 8: 13,974,527 probably benign Het
Tg G T 15: 66,693,319 C1170F probably damaging Het
Tnks A T 8: 34,851,783 D781E probably benign Het
Tnp2 T A 16: 10,788,343 T87S possibly damaging Het
Tpp2 T C 1: 43,971,715 V554A probably benign Het
Traf3ip2 T C 10: 39,645,739 I431T probably damaging Het
Trav9d-4 A T 14: 52,983,801 H84L probably damaging Het
Vmn2r42 T A 7: 8,184,277 Y782F probably damaging Het
Vwf T C 6: 125,570,604 S231P probably damaging Het
Wdr83os A G 8: 85,081,867 S83G probably damaging Het
Wdr91 T A 6: 34,908,299 Q109L probably damaging Het
Znrf4 A G 17: 56,511,864 C148R possibly damaging Het
Other mutations in Rbm12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:Rbm12 APN 2 156096041 intron probably benign
IGL01307:Rbm12 APN 2 156095382 intron probably benign
IGL02474:Rbm12 APN 2 156098097 missense probably damaging 1.00
IGL02596:Rbm12 APN 2 156095560 intron probably benign
IGL02601:Rbm12 APN 2 156095560 intron probably benign
IGL02603:Rbm12 APN 2 156095560 intron probably benign
IGL02608:Rbm12 APN 2 156095898 intron probably benign
IGL02679:Rbm12 APN 2 156095560 intron probably benign
IGL02691:Rbm12 APN 2 156095560 intron probably benign
IGL02693:Rbm12 APN 2 156095560 intron probably benign
IGL02702:Rbm12 APN 2 156095560 intron probably benign
IGL02703:Rbm12 APN 2 156095560 intron probably benign
IGL03407:Rbm12 APN 2 156097564 nonsense probably null
IGL02991:Rbm12 UTSW 2 156095560 intron probably benign
R0310:Rbm12 UTSW 2 156095724 intron probably benign
R1213:Rbm12 UTSW 2 156097492 nonsense probably null
R1280:Rbm12 UTSW 2 156096829 missense probably damaging 1.00
R1511:Rbm12 UTSW 2 156097536 missense probably damaging 0.98
R1951:Rbm12 UTSW 2 156097213 missense probably damaging 0.99
R2131:Rbm12 UTSW 2 156095510 nonsense probably null
R2133:Rbm12 UTSW 2 156095510 nonsense probably null
R2883:Rbm12 UTSW 2 156097075 missense probably damaging 0.98
R4783:Rbm12 UTSW 2 156096564 missense possibly damaging 0.95
R4784:Rbm12 UTSW 2 156096564 missense possibly damaging 0.95
R4785:Rbm12 UTSW 2 156096564 missense possibly damaging 0.95
R4794:Rbm12 UTSW 2 156095569 intron probably benign
R5057:Rbm12 UTSW 2 156096886 missense probably benign 0.18
R5383:Rbm12 UTSW 2 156103365 utr 5 prime probably benign
R5599:Rbm12 UTSW 2 156096793 nonsense probably null
R5979:Rbm12 UTSW 2 156097759 intron probably benign
R6083:Rbm12 UTSW 2 156097726 intron probably benign
R6769:Rbm12 UTSW 2 156097455 missense possibly damaging 0.95
R6771:Rbm12 UTSW 2 156097455 missense possibly damaging 0.95
R7233:Rbm12 UTSW 2 156095974 missense unknown
R7424:Rbm12 UTSW 2 156097303 missense possibly damaging 0.57
R7483:Rbm12 UTSW 2 156098218 missense unknown
R7643:Rbm12 UTSW 2 156098217 missense unknown
Predicted Primers PCR Primer
(F):5'- TTATGACGACAGAGAGCAGCC -3'
(R):5'- CCCCTCAAGATACATTTGAAGC -3'

Sequencing Primer
(F):5'- GAGCAGCCTTATAGTCAGCATCATTC -3'
(R):5'- CATTTGAAGCTTTGAAACGGAACAG -3'
Posted On2015-11-11