Incidental Mutation 'R4760:Sall4'
ID356777
Institutional Source Beutler Lab
Gene Symbol Sall4
Ensembl Gene ENSMUSG00000027547
Gene Namespalt like transcription factor 4
Synonyms5730441M18Rik, Tex20, C330011P20Rik
MMRRC Submission 041974-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4760 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location168748332-168767943 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 168750427 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 936 (S936P)
Ref Sequence ENSEMBL: ENSMUSP00000029061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029061] [ENSMUST00000075044] [ENSMUST00000103074] [ENSMUST00000150588]
Predicted Effect probably damaging
Transcript: ENSMUST00000029061
AA Change: S936P

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029061
Gene: ENSMUSG00000027547
AA Change: S936P

DomainStartEndE-ValueType
low complexity region 15 24 N/A INTRINSIC
low complexity region 25 42 N/A INTRINSIC
ZnF_C2H2 68 88 1.31e2 SMART
low complexity region 193 203 N/A INTRINSIC
low complexity region 210 230 N/A INTRINSIC
low complexity region 254 278 N/A INTRINSIC
low complexity region 295 313 N/A INTRINSIC
ZnF_C2H2 387 409 1.04e-3 SMART
ZnF_C2H2 415 437 2.15e-5 SMART
ZnF_C2H2 573 595 5.34e0 SMART
ZnF_C2H2 601 623 1.22e-4 SMART
ZnF_C2H2 633 655 1.84e-4 SMART
low complexity region 855 867 N/A INTRINSIC
ZnF_C2H2 880 902 2.53e-2 SMART
ZnF_C2H2 908 930 1.13e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075044
AA Change: S147P

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000074556
Gene: ENSMUSG00000027547
AA Change: S147P

DomainStartEndE-ValueType
low complexity region 15 24 N/A INTRINSIC
low complexity region 30 38 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
ZnF_C2H2 91 113 2.53e-2 SMART
ZnF_C2H2 119 141 1.13e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103074
AA Change: S492P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000099363
Gene: ENSMUSG00000027547
AA Change: S492P

DomainStartEndE-ValueType
low complexity region 15 24 N/A INTRINSIC
low complexity region 25 42 N/A INTRINSIC
ZnF_C2H2 68 88 1.31e2 SMART
low complexity region 193 203 N/A INTRINSIC
low complexity region 210 230 N/A INTRINSIC
low complexity region 254 278 N/A INTRINSIC
low complexity region 295 313 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
ZnF_C2H2 436 458 2.53e-2 SMART
ZnF_C2H2 464 486 1.13e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150588
SMART Domains Protein: ENSMUSP00000119628
Gene: ENSMUSG00000027547

DomainStartEndE-ValueType
ZnF_C2H2 64 86 1.22e-4 SMART
ZnF_C2H2 96 118 1.84e-4 SMART
Meta Mutation Damage Score 0.108 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: This gene belongs to the spalt family of zinc finger transcription factors. In mouse, functions for this gene have been described in many embryonic developmental processes, including brain, heart, and limb development. In addition, this gene is an important pluripotency factor that is required for stem cell maintenance. Homozygous mutant mice display embryonic lethality, while conditional knock-out in embryonic germ cells results in failure to establish a robust stem cell population. A pseudogene of this gene is found on chromosome 2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous mutation of this gene results in early embryonic lethality before somite formation. Heterozygous mutation of this locus causes variable phenotypes, from heart and digit defects to deafness, anogenital tract defects, cranial and carpal bone defects and renal agenesis or hypoplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,721,305 M723K probably benign Het
A530053G22Rik A G 6: 60,402,101 noncoding transcript Het
Abcc2 A T 19: 43,810,481 Y512F probably benign Het
Adgrb1 T A 15: 74,571,463 I51N probably damaging Het
Adhfe1 A G 1: 9,563,523 Y332C probably damaging Het
Ambn C T 5: 88,467,707 L317F probably damaging Het
Amn1 T C 6: 149,185,113 Y17C probably benign Het
Apoa5 T C 9: 46,270,295 V223A probably damaging Het
BC048403 T C 10: 121,740,007 V11A probably damaging Het
Best3 A T 10: 117,024,794 H653L probably benign Het
Btnl2 C A 17: 34,363,195 S245Y probably damaging Het
Camk1d A G 2: 5,362,056 L116P probably damaging Het
Catsperg2 T A 7: 29,705,635 D698V probably damaging Het
Cd33 T C 7: 43,529,495 T307A probably benign Het
Cdk8 C T 5: 146,292,666 S230L probably benign Het
Cfap69 C T 5: 5,646,939 C119Y probably damaging Het
Chat T C 14: 32,453,737 N122S probably benign Het
Col20a1 A T 2: 180,984,403 probably benign Het
Cyp2j9 A T 4: 96,568,791 L481Q probably damaging Het
Dab1 A C 4: 104,732,145 S550R probably damaging Het
Dlgap2 A C 8: 14,773,380 Q533P probably damaging Het
Eif4g3 A T 4: 138,084,318 Q31L possibly damaging Het
Ets2 G A 16: 95,719,043 V438M probably damaging Het
Eva1c G A 16: 90,904,250 D258N probably benign Het
Fastkd2 A G 1: 63,745,886 H477R probably benign Het
Fga T G 3: 83,031,514 S399A probably benign Het
Fmo4 T A 1: 162,809,827 E32V probably damaging Het
Gm13083 G A 4: 143,617,231 R367K probably benign Het
Gm1840 G A 8: 5,640,473 noncoding transcript Het
Gm7204 T A 16: 48,218,688 noncoding transcript Het
Hhipl1 A G 12: 108,320,077 I548V probably damaging Het
Hsfy2 T C 1: 56,637,190 T63A probably benign Het
Igf2r A G 17: 12,703,465 V1254A possibly damaging Het
Ighv8-4 A T 12: 115,024,047 D110E probably damaging Het
Igkv14-130 T C 6: 67,791,462 S101P probably benign Het
Igkv9-120 G T 6: 68,050,367 R88S possibly damaging Het
Ipo5 T C 14: 120,941,642 V779A probably benign Het
Itpr1 C T 6: 108,349,632 T105I probably benign Het
Kalrn T C 16: 34,198,487 M670V probably damaging Het
Kdm8 T A 7: 125,455,259 probably null Het
L3hypdh T C 12: 72,077,242 I281V probably benign Het
Lins1 T G 7: 66,714,687 probably benign Het
Map4k5 T A 12: 69,824,598 I517L possibly damaging Het
March2 G T 17: 33,709,916 T2K probably damaging Het
Mlkl C G 8: 111,319,716 probably null Het
Mllt1 A G 17: 56,902,630 M160T probably benign Het
Mmp15 G A 8: 95,368,196 A233T possibly damaging Het
Moxd2 C A 6: 40,891,603 T23N probably benign Het
Nop53 C A 7: 15,942,887 K100N probably benign Het
Nrg1 C A 8: 31,918,200 E2* probably null Het
Olfr654 T A 7: 104,588,489 H228Q probably benign Het
Pank4 A G 4: 154,974,634 D408G possibly damaging Het
Pcdhb10 T C 18: 37,411,942 W24R probably benign Het
Pcm1 C T 8: 41,287,738 T968I probably damaging Het
Pkib G T 10: 57,708,150 M19I probably benign Het
Ppy A G 11: 102,100,519 probably null Het
Prdx3 A C 19: 60,873,183 C39W possibly damaging Het
Qrfpr T G 3: 36,221,924 N106H probably benign Het
Rai14 G A 15: 10,575,690 T394M possibly damaging Het
Ralgapa2 A T 2: 146,346,749 L1371Q probably benign Het
Rbm12 A G 2: 156,097,128 L408P probably damaging Het
Rdx T C 9: 52,065,874 I141T probably benign Het
Reep1 T A 6: 71,708,001 V11E possibly damaging Het
Serac1 A G 17: 6,051,790 M403T possibly damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc35g2 T G 9: 100,553,496 I41L probably benign Het
Slc39a12 G A 2: 14,400,323 S242N probably benign Het
Slc9a2 T A 1: 40,761,916 D535E probably damaging Het
Spata31d1a G T 13: 59,701,645 P890T probably damaging Het
Sync A G 4: 129,293,439 Q88R probably benign Het
Tdrp A G 8: 13,974,527 probably benign Het
Tg G T 15: 66,693,319 C1170F probably damaging Het
Tnks A T 8: 34,851,783 D781E probably benign Het
Tnp2 T A 16: 10,788,343 T87S possibly damaging Het
Tpp2 T C 1: 43,971,715 V554A probably benign Het
Traf3ip2 T C 10: 39,645,739 I431T probably damaging Het
Trav9d-4 A T 14: 52,983,801 H84L probably damaging Het
Vmn2r42 T A 7: 8,184,277 Y782F probably damaging Het
Vwf T C 6: 125,570,604 S231P probably damaging Het
Wdr83os A G 8: 85,081,867 S83G probably damaging Het
Wdr91 T A 6: 34,908,299 Q109L probably damaging Het
Znrf4 A G 17: 56,511,864 C148R possibly damaging Het
Other mutations in Sall4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Sall4 APN 2 168755312 missense probably benign 0.02
IGL00592:Sall4 APN 2 168755963 missense probably damaging 1.00
IGL00674:Sall4 APN 2 168755780 missense probably damaging 0.99
IGL01308:Sall4 APN 2 168750244 missense probably damaging 0.99
IGL01538:Sall4 APN 2 168755856 missense probably damaging 1.00
IGL01552:Sall4 APN 2 168756123 missense probably damaging 1.00
IGL02614:Sall4 APN 2 168755885 missense probably null 0.79
R0514:Sall4 UTSW 2 168755705 missense probably damaging 1.00
R0531:Sall4 UTSW 2 168756336 missense probably benign 0.10
R0747:Sall4 UTSW 2 168754966 missense probably damaging 1.00
R1371:Sall4 UTSW 2 168756474 missense probably benign 0.10
R1736:Sall4 UTSW 2 168752635 missense probably benign 0.10
R2067:Sall4 UTSW 2 168756545 missense probably benign 0.00
R3766:Sall4 UTSW 2 168756044 missense possibly damaging 0.93
R3783:Sall4 UTSW 2 168756123 missense probably damaging 1.00
R3784:Sall4 UTSW 2 168756123 missense probably damaging 1.00
R3785:Sall4 UTSW 2 168756123 missense probably damaging 1.00
R3787:Sall4 UTSW 2 168756123 missense probably damaging 1.00
R3877:Sall4 UTSW 2 168756242 missense probably damaging 1.00
R4356:Sall4 UTSW 2 168755480 missense probably benign 0.37
R4358:Sall4 UTSW 2 168755480 missense probably benign 0.37
R4869:Sall4 UTSW 2 168755717 missense probably damaging 1.00
R5979:Sall4 UTSW 2 168750343 missense probably benign 0.28
R6089:Sall4 UTSW 2 168755486 missense possibly damaging 0.92
R6502:Sall4 UTSW 2 168755708 missense probably damaging 1.00
R6990:Sall4 UTSW 2 168755070 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATCTCGTTGGTCTTCATGGCC -3'
(R):5'- CACAAGCATGCTCTCAACTG -3'

Sequencing Primer
(F):5'- GTCTTCATGGCCAGACCC -3'
(R):5'- CTGGCTTACTGATACAAGATCTGAC -3'
Posted On2015-11-11